Table 2.

Forward rDNA PCR primers used in the survey of environmental DNA samples

Phylogenetic groupPrimer (reference)aNucleotide sequence (5′→3′)bTarget regioncOptimum annealing temp (°C)d
All bacteriapA (10)AGAGTTTGATCCTGGCTCAG8–2742
KingdomAcidobacterium 31FGATCCTGGCTCAGAATC15–3142
Subgroupse
 AAGCCTGAGAGGGCRC293–30650
 GGCGCAAGCCTGACGAC379–39360
 OOCGACGGTACCTTGCGT480–49757
 YYGGTACYGTTTGTAAGSTC484–50357
  • a All primers, except pA, were designed in this study.

  • b R, mixture of G and A (1:1); Y, mixture of C and T (1:1); S, mixture of C and G (1:1).

  • c Positions correspond to E. colinucleotide numbering (14).

  • d Optimum PCR annealing temperature for specificity, when used with the 1492R reverse primer.

  • e Subgroups as indicated in Fig. 1.