Table 1.

Oligonucleotides used for cloning and sequencing ofnosZ gene fragments

OligonucleotideaSequenceb
Cloning primers
 CAMP-Nos661F 5′CUACUACUACUACGGCUGGGGGCUGACCAA
 CAMP-Nos1773R 5′CAUCAUCAUCAUAURUCGAUCARCUGBUCGUU
Sequencing primers
 NosGrpA-For 5′CGAYGCCGACTATCAGGG
 NosGrpA-Rev 5′CCCTGATAGTCGGCRTCG
 NosGrpB-For 5′GCCTGGCARGTSATVGTBGACGG
 NosGrpB-Rev 5′CCGTCVACBATSACYTGCCAGGC
 NosGrpC-For 5′CAYGAAGCRCCRYTGGTCAA
 NosGrpC-Rev 5′TTGACCARYGGYGCTTCRTG
 Nos1319R 5′GTBGGBGAVARCTTGCC
  • a All numbers are relative to thenosZ sequence of P. stutzeri Zobell.

  • b B = C, G or T; R = A or G; S = C or G; V = A, C or G; Y = C or T.