TABLE 1

PCR primers used for construction of T. thermophilus HB27 knockout mutants

Mutant strainPrimer namePrimer sequenceaProduct size (bp)Target
Δoah2 strainoas 720 RI for1GGATGCAGCAGCCCTGGAATTCGTAGTAGG418oah2 upstream sequence
oas 1100 KpnI Rev1aGTCTTCGGGAAGCCCGGCGAGGGTACCGAGGGTGGTGTA
pUC-HTK 670 forGCTTGCATGCGGGGTACCCTAGAATTCAT800HTK gene
pUC-HTK 1450 Xba RevGAGGTCATCGTCTAGAATGGTATGC
oas 2310 XbaI for2CCTGGAGGCGGTCCATATGCTCTAGACCAT470oah2 downstream sequence
oas 2750 PstI Rev2GGTTCTTCTCCATGCCTGCAGGCTAGACC
oas del for3GGTCTTCACGGGCTTGCCCTGAAAGG595Sequencing
HTK 5′ revGCTGAACTCTACTCCCTCTGTTGACAGAACAC
Δoah1 strainA HTKoah1upforGACTTTGGAAAGGAGGCCAAGGATGAAAGGACCAATAATAATGA761HTK gene
B HTKmet2revCGAGGGCGATCTCGCTCATTCAAAATGGTATGCGT
E oah1uprevTCATCCTTGGCCTCCTTTCCAAAGT559oah1 upstream sequence
1 oah1 ecoRICCTCGAATTCCACGTCCCCG
F met2forATGAGCGAGATCGCCCTCG366oah1 downstream sequence
4 met2revGGCGGGGTCCAGGATCC
htkoah1uprevTCATTATTATTGGTCCTTTCATCCTTGGCCTCCTTTCCAAAGTC1,772Sequencing
htkmet2forACGCATACCATTTTGAATGAGCGAGATCGCCCTCG
ΔbshC strainB spo htk revCTAACCCTTCTTCAAAATGGTATGCGTTTTGAC786HTK gene
A crp htk forTAGGCTTTAAAGCATGAAAGGACCAATAATAATGAC
E htk crp revGGTCCTTTCATGCTTTAAAGCCTAAAGTTCC513bshC upstream sequence
1 crp bamHI forCTCGTCGGGATCCACCGG
F htk spo forGCATACCATTTTGAAGAAGGGTTAGGATGTTCG378bshC downstream sequence
4 spodown psti revAGGTAGTCCTGCAGGGGAAGG
5 bshC forGTCCTTTGCGCTTGAGGCG1,774Sequencing
6 bshC revACGGCCTGGGCCTTCA
ΔbshA strainA perm HTK forCTAGGCTTAGGGCATGAAAGGACCAATAATA785HTK gene
B bshA htk revGGGCGTAGACTCAAAATGGTATGCG
E htk perm revTTATTGGTCCTTTCATGCCCTAAGCCTAG458bshA upstream sequence
1perm ecoR1 forGCGCCGGGAATTCCGG
F HTK bshA forACCATTTTGAGTCTACGCCCAGG714bshA downstream sequence
4 prot PstI revGAGAAGGACCTGCAGGCCTAC
5 perm upins forAGACCCTCACCCTCAAGGACT2,062Sequencing
6 pro downins revGCCCTCCTCCGCAAGG
ΔtrxA2 strainA trx2upHTKGCGGAGGGGGTACCTATGAAAGGACCAATAATAAT796HTK gene
B hsp20HTK revTCCCTTCTAGGTAGGGCCTTCAAAATGGTATGCG
E HTKuptrx2 revATTATTGGTCCTTTCATAGGTACCCCCTCCG539trxA2 upstream sequence
1 trx2 ecoR1 forGAAAGGGAATTCCAGCTTGCGGG
4 hsp20 bamH1 revCGGGGGATCCGCACCT403trxA2 downstream sequence
F HTKtrx2forGCATACCATTTTGAAGGCCCTACCTAGAAGG
5 trx2upst forCTTCTGGACCTGAGGGCGA1,465Sequencing
6 hsp20downst revTTTCCTGAATGGGTATCCGCACG
ΔtrxA strainA trx1 htk forCGTAGAGTAGGGGGGTATGAAAGGACCAATAATAATG791HTK gene
B2 trx1GTCCAGGGCGATGCGCATCCTCAAAATGG
E htktrx1 revATTGGTCCTTTCATACCCCCCTACT486trxA1 upstream sequence
1 trx1 ecoR1 forCGCGGGTGAATTCCGCG
F htkphos forCATACCATTTTGAGGATGCGCATCGC397trxA1 downstream sequence
4 phos bamH1 revTCAAGCTGGGGATCCCCAC
5 trx1 upsisn forGGACCTTCGCCGAGCTCC1,752Sequencing
6 Phos downins revGGACGAGGAAGGAAGGGCG
  • a Underlined sequences indicate restriction enzyme cutting sites.