Table 2.

Expression of cry1-lacZ fusions in variousB. thuringiensis subspecies

lacZ fusionSp act of β-galactosidase ina:
Strain 80-21Strain 5Strain HD124-12Strain HD112
cry1A b 39.011.036.010.0
cry1C c 30.026.0NDe ND
Bendd 31.032.0ND 19.0
IRd 30.029.0ND ND
cry1A promoters only8.07.5ND ND
  • a Average values expressed as the maximum number of Miller units per unit of absorbance at 600 nm at the end of growth; the coefficients of variation were less than ± 10%. The values for strains 80-21 and 5 are the values obtained for the original transformants with plasmids isolated from E. coli. ThelacZ fusion plasmid from strain 5 was electroporated into HD124-12. This plasmid and the other plasmids were also reintroduced into strain 80-21, and the plasmids from strain 80-21 were electroporated into strain 5.

  • b A 280-bp region upstream of the promoters was ligated to the cry1A-272–lacZ fusion (29).

  • c A 780-bp region upstream of thecry1C promoters was ligated to thecry1A-272–lacZ fusion.

  • d The 280-bp cry1A upstream region was ligated to cry1A-272–lacZ, but the potential bend or IR region was mutated (Fig. 1) (32). The bend mutation (Fig. 1, boldface region) involved changes in 5′CTCAGTCTGTCTATGTAGAACAGGACAAGTG (changes in boldface type). The IR was mutated to 5′CCTGCAGTTAAGCCTGAATTGTAAATGC.

  • e ND, not determined.