Table 3.

Probe binding site sequences for fluorogenic PCR-negative isolates

  Probe or
   B. cereusstrain
Sequencea
cerTAQ-1 probe 5CGTAATCTTGTTTCGCAACTACTGC3
3-V 3 TCATTAGAACAAAGCGGTGATGACG5
JAP IV 3 TCATTAGAACAAAGCGATGATGACG5
7-V 3 TCATTAGAACAAAGCGACGATGACG5
SSA-70 3 TCATTAGAACAAAGCGACGATGACG5
T-2 3 TCATTAGAACAAAGCGACGATGACG5
7-P 3 TCATTAGAACAAAGCGACGATGACG5
  • a Boldface indicates additional polymorphic sequences in the cereolysin probe target.