Table 1.

Oligonucleotide primers used (positions are relative to those of E. coli) for 16S rDNA sequence analysis and ribotyping

PrimerSequencePositions relative to those of E. coli
fD1a 5′ AGAGTTTGATCCTGGCTCAG 3′8–27
rP2a 5′ ACGGCTACCTTGTTACGACTT 3′1513–1494
EBA-1b 5′ GCCACATTGGGACTGAGACA 3′310–329
But-3b 5′ GGAATTCCTAGTGTAGCGGT 3′673–692
Uniseq1c 5′ ATGTTGGGTTAAGTCCCGCAAC 3′1082–1103
P3-Modd 5′ ATTAGATACCCTDGTAGTCC 3′787–806
PC5d 5′ TACCTTGTTACGACTT 3′1507–1487
  • a Reference 47.

  • b This work.

  • c Reference 34.

  • d Reference 49.