Table 2.

PCR primers

PrimerSequence (5′ to 3′)Source or reference
1247AAGAGCCCGTAkopyanz et al. 1
1253GTTTCCGCCCAkopyanz et al.1
1281AACGCGCAACAkopyanz et al.1
1283GCGATCCCCAAkopyanz et al.1
1290GTGGATGCGAAkopyanz et al.1
D8635GAGCGGCCAAAGGGAGCAGACAkopyanz et al. 1
D9355CCGGATCCGTGATGCGGTGCGAkopyanz et al. 1
NP-2CGGGGGACTGTTGGGCGCCATCTFani et al. 7
A-1GAGGCCCTTCFritsch et al.
70-31GCCCCTCTTGGenosys Biotech
70-32GGACCGACTGGenosys Biotech
70-33CTGTCGGCTCGenosys Biotech
70-34GGACCGCTAGGenosys Biotech
70-35CATGTCCGCCGenosys Biotech
70-36GCACGTGAGGGenosys Biotech
70-37CTATCGCCGCGenosys Biotech
70-38GAGAGGGAGGGenosys Biotech
70-39CCGGGGTTACGenosys Biotech
70-40CGCAGACCTCGenosys Biotech
10-40CGCAGACCTCGenosys Biotech
CLF-4AGACACGGCCCAGACTCCTAPC-Gene database
StreptomycesspecificGCGTCGAATTAAGCCACAWellington et al.39