Table 2.

Data on probes used in the present study

ProbeTarget (positions)aSequence (5′→3′)Applied stringency (formamide concn [%])Source or reference
XAN818 Xanthomonasbranch 16S rRNA (818–835)CAACATCCAGTTCGCATC10This study
EUB338Bacterial 16S rRNA (338–355)GCTGCCTCCCGTAGGAGT10 4
EUK516Eucaryal 18S rRNA (502–516)ACCAGACTTGCCCTCC20 4
ARCH915Archaeal 16S rRNA (915–934)GTGCTCCCCCGCCAATTCCT20 33
ALF968α-proteobacterial 16S rRNA (968–986)GGTAAGGTTCTGCGCGTT35 23
BET42aβ-proteobacterial 23S rRNA (1027–1043)GCCTTCCCACTTCGTTT35 19
CF319a Cytophaga-Flavobacterium cluster of CFB phylum 16S rRNA (319–336)TGGTCCGTGTCTCAGTAC35 18
GAM42aγ-proteobacterial 23S rRNA (1027–1043)GCCTTCCCACATCGTTT35 19
HGC69aActinobacterial (Firmicutes with high DNA G+C content) 23S rRNA (1901–1918)TATAGTTACCACCGCCGT20 30
LGC354a Firmicutes with low DNA G+C content 16S rRNA (354–371)TGGAAGATTCCCTACTGC35 20
LGC354b Firmicutes with low DNA G+C content 16S rRNA (354–371)CGGAAGATTCCCTACTGC35 20
LGC354c Firmicutes with low DNA G+C content 16S rRNA (354–371)CCGAAGATTCCCTACTGC35 20
PLA46Planctomycetal 16S rRNA (46–63)GACTTGCATGCCTAATCC35 24
NON338Negative controlACTCCTACGGGAGGCAGC10 38
  • a E. coli numbering (6).