Table 2.

Data on probes used in the present study

ProbeTarget (positions)aSequence (5′→3′)Applied stringency (formamide concn [%])Source or reference
XAN818Xanthomonasbranch 16S rRNA (818–835)CAACATCCAGTTCGCATC10This study
EUB338Bacterial 16S rRNA (338–355)GCTGCCTCCCGTAGGAGT104
EUK516Eucaryal 18S rRNA (502–516)ACCAGACTTGCCCTCC204
ARCH915Archaeal 16S rRNA (915–934)GTGCTCCCCCGCCAATTCCT2033
ALF968α-proteobacterial 16S rRNA (968–986)GGTAAGGTTCTGCGCGTT3523
BET42aβ-proteobacterial 23S rRNA (1027–1043)GCCTTCCCACTTCGTTT3519
CF319aCytophaga-Flavobacterium cluster of CFB phylum 16S rRNA (319–336)TGGTCCGTGTCTCAGTAC3518
GAM42aγ-proteobacterial 23S rRNA (1027–1043)GCCTTCCCACATCGTTT3519
HGC69aActinobacterial (Firmicutes with high DNA G+C content) 23S rRNA (1901–1918)TATAGTTACCACCGCCGT2030
LGC354aFirmicutes with low DNA G+C content 16S rRNA (354–371)TGGAAGATTCCCTACTGC3520
LGC354bFirmicutes with low DNA G+C content 16S rRNA (354–371)CGGAAGATTCCCTACTGC3520
LGC354cFirmicutes with low DNA G+C content 16S rRNA (354–371)CCGAAGATTCCCTACTGC3520
PLA46Planctomycetal 16S rRNA (46–63)GACTTGCATGCCTAATCC3524
NON338Negative controlACTCCTACGGGAGGCAGC1038
  • a E. coli numbering (6).