Table 1.

Oligonucleotide probes used for FISH

ProbeSpecificityProbe sequence (5′–3′)Target sitea 16S rRNA positions% FAbSource or reference
ALT1413 Alteromonas,Colwellia TTTGCATCCCACTCCCAT1413–143040This study
G Rb Rhodobacter,Roseobacter GTCAGTATCGAGCCAGTGAG645–6263018
G V Vibrio AGGCCACAACCTCCAAGTAG841–8223018
NOR1-56NOR1 lineageTTACCGCTCGGACTTGCA56–7320This study
NOR2-1453NOR2 cluster group AGGTCATCGCCATCCCC1453–146830This study
OCE232 Oceanospirillum AGCTAATCTCACGCAGGC232–24940This study
PSA184 Pseudoalteromonas,Colwellia CCCCTTTGGTCCGTAGAC184–21030This study
SAR86-1249SAR 86 clusterc GGCTTAGCGTCCGTCTG1249–126550This study
SPH120 Sphingomonas GGGCAGATTCCCACGCGT120–1373036
  • a E. coli numbering (8).

  • b Percent (vol/vol) formamide (FA) in FISH buffer.

  • c Reference 35.