Table 1.

DNA primers used for amplification of specific genes

GenePrimer namePrimer sequence (5′→3′)Gene source (size [kb])Product size (bp)Reference or source
mobA n-mobACGCGCAGGCGGGCTATCAGTCp4821 (3.3)576 18
c-mobACCAAAGCCACATCATTTGC
cdaA n-cdaACTCGATGGTCGTGTGGCCGpColD157 (6.7)632 20
c-cdaAGGAGTATTCATCTGACCCACAC
L7095n-L7095CAGTTCGCTCGTAAAGCAGpO157 (92)668 6, 29
c-L7095GTATAAATGGCTCTATGTCTAC
hlyCAa n-hlyCACTTTTGACGTCATGGGGAAGGpO157 (92)792 6, 29
c-hlyCACGAATATTGCAACACCACGTTCAG
stx1 stx-1FACACTGGATGATCTCAGTGGPhage 933J614 16
stx-1RCTGAATCCCCCTCCATTATG
stx2 stx-2FCCATGACAACGGACAGCAGTTemperate phage 933W779 16
stx-2RCCTGTCAACTGAGCACTTTG
eaeA n-eaeCCCGAATTCGGCACAAGCATAAGCChromosomal DNA863 44
c-eaeCCCGAATCCGTCTCGCCAGTATTCG
uidA n-uidACTCTACACCACGCCGAACACChromosomal DNA922 26
c-uidACCTTCTCTGCCGTTTCCAAAT
933WW61311FGTCAGTATGCGATAGCTCTGDNA endpoints of 933W660 42
W300RGCGACATGGGATTCATTCAGC
gfp n-gfpATGAGTAAAGGAGAAGAACTTTTCpGFP800Clontech
c-gfpCGAAAGGGCCCGTACGGCCG
  • a The primer set n-hlyCA and c-hlyCA was designed to amplify the C- and N-terminus-encoding portions ofhlyC and hlyA, respectively, from the pO157 hemolysin operon, hlyCABD.