Table 2.

PCR primers, 5′-nuclease assay probes, and optimal reaction conditions tested in this study

SetTarget groupAnnealing temp (°C) MgCl2(mM)TypePrimer or probe name (optimized concn); 5′-to-3′ sequence; and targetPrimer propertiesGeneral comments
BACT1 Bacteria 593Forward primerBACT1369F (1,000 nM); CGGTGAATACGTTCYCGG; and Bacteria Major mismatchesa with Chlorobium spp.,Planctomyces phylum, Synechococcus, andCytophagales; Underestimates copy numbers of rDNA of Synechococcus; apparently underestimates total copy numbers of bacterial SSU rDNA in environmental samples
Reverse primerPROK1541R (1,000 nM); AAGGAGGTGATCCRGCCGCA; and prokaryotes Major mismatches with someVibrio spp. Limited number of sequences for priming region
ProbeTM1389F (500 nM); CTTGTACACACCGCCCGTC; and prokaryotes
BACT2 Bacteria 563Forward primerBACT1369F (1,500 nM); CGGTGAATACGTTCYCGG; andBacteria Major mismatchesa withChlorobium spp. and Planctomyces phylum Low melting tempBest primer set for bacterial SSU rDNA; low annealing and extension temperatures seem to necessitate high-qualityTaq DNA polymerase
Reverse primerPROK1492R (1,000 nM); GGWTACCTTGTTACGACTT; and prokaryotes
ProbeTM1389F (500 nM); CTTGTACACACCGCCCGTC; and prokaryotes
ARCH1 Archaea 593Forward primerARCHMIX1369F (500 nM), 1:1 mixture of ARCH1-1369F, CGGTGAATACGTCCCTGC, and ARCH2-1369F, CGGTGAATATGCCCCTGC; andArchaea Major mismatchesa with Methanococcales andMethanosarcinales Apparently underestimates total copy numbers of group II Marine Archaea(Euryarchaeota) SSU rDNA in environmental samples
Reverse primerPROK1541R (1,000 nM); AAGGAGGTGATCCRGCCGCA; and prokaryotes
ProbeTM1389F (500 nM); CTTGTACACACCGCCCGTC; and prokaryotes
PHPICO Synechococcus and Prochlorococcus 595Forward primerPHPICO191F (500 nM); TGAAATGAATTTCGCCTGAG; and SynechococcusgroupIn Monterey Bay, appears to overestimate percentages ofProchlorococcus plus Synechococcus compared to flow cytometer cell counts
Reverse primerPHPICO420R (500 nM); AGAAAAGAGGTTTACAGCCCAG; andSynechococcus group
ProbePHPICO283F (500 nM); CAGTAGCTGGTCTGAGAGGATGATC; and Synechococcus group
ARCHGIGroup I marine Archaea(Crenarcheota)595Forward primerARCHGI334F (1,000 nM); AGATGGGTACTGAGACACGGAC; and group I marineArchaea
Reverse primerARCHGI554R (500 nM); CTGTAGGCCCAATAATCATCCT; and group I marine Archaea
ProbeTM519AR (400 nM); TTACCGCGGCGGCTGGCAC; andArchaea
ARCHGIIGroup II marineArchaea (Euryarchaeota)595Forward primerARCHGII333F (1,000 nM); GAGATGGATTCTGAGACACGAA; and group II marine Archaea
Reverse primerARCHGII554R (1,000 nM); TTAGGCCCAATAAAAKCGAC; and group II marine Archaea
ProbeTM519AR (400 nM); TTACCGCGGCGGCTGGCAC; and Archaea
pUCpUC-derived plasmids595Forward primerPUCF (500 nM); and CGCAACGCAATTAATGTGAGTTA
Reverse primerPUCR (500 nM); and AATCATGGTCATAGCTGTTTCCTG
ProbeTMPUC (400 nM); and AAATTGTTATCCGCTCACAATTCCACAC
  • a Major mismatches are defined as two or more mismatches (excluding GT mismatches) in the last five 3′-end positions of the primer or four or more mismatches in the entire primer.