Table 1.

Primers and probes used in TNAs

Primer or probeaSequence (5′→3′)bTm (°C)c
Primers
 PITSANFCGTAACAAGGTAGCCGTAC50
 PITSENDCTCTGTGTGCCAAGGTATC50
 P8807APCATTCTTGACAAGTTAACCAGTTAGCTG60
 P8807AMCAAGGTTCTGCTGACATTCAAACA60
 P8807PEGTGATCTTGACTGTTGTTCGCTGA60
 P100PAGGTTTAGCTCAGTTGGTAGAGCGC61
 P3TTGGATGGAGGTTAGCGGACT60
Probes
 S8807R–ATTTGTGCT–QCTCGGCTTTACCCGC67
 S8807AR–TCTCCAGGGCAGCATTGAATCCAG–Q67
 S100AR–CTTTGCAAGCAGGATGTCAGCGGTT–Q68
  • a Primers and probes were designed to match complementary sequences in Synechococcus sp. strain BO 8807.

  • b The localization of the fluorescent dyes of the probes is indicated by the letters R (reporter, FAM) and Q (quencher, TAMRA).

  • c Tm was calculated using Primer Express primer design software (see Materials and Methods).