Table 2.

List of primers

OligonucleotideSequencea,bRestriction site(s)
AB015′-GGCCGGATCCGAATTACATTTTAACGATATC-3′ BamHI
AB02c 5′-GCGCTTAATTAAACCACTTTGTTAACGCTTACAAAATAGTT-3′ PacI
AB035′-GCGCTTAATTAACATTAGGAAGGACGCTTTCTT-3′ PacI
AB045′-CCGGATCCGCTTATAAACCAGCAATTTCCTC-3′ BamHI
AB055′-GGAAGGATCCGCGCTTAATTAAACCACTTTGTTAACGCTT-3′ BamHI/PacI
AB065′-GGAAAGATCTTTACATTTTAACGATATCTAGAAAAT-3′ BglII
AB07d 5′-CCTGCCCGGG/TTAATTAACATTAGGAAGGAGCG TTTCTTTAAATGAATGTGTTATCCTCAATTTGTTACGG-3′ SmaI/PacI
AB08e 5′-GGAAGGATCC/AAGCTT/GCGGCCGC/CCGGGC/TAGCCTAAACCTTCCCGGCTTCATCATGCTCTCT-3′ BamHI/HindIII/ NotI/SrfI/NheI
AB095′-GGCGGATCC/AGATCTCTAAACCTTCCCGG-3′ BamHI/BglII
  • a Restriction sites are indicated in italics.

  • b Multiple restriction sites are separated by a forward slash (/).

  • c Underlined text indicates the optimized CRE site, and bold text indicates mismatches from the xylA CRE site.

  • d Underlined text indicates the ribosome binding site, and bold text indicates a 9-bp spacer between the ribosome binding site and the initiation codon.

  • e Underlined text indicates bases shared by two restriction sites.