Table 1.

Oligonucleotide probes used in this study

ProbeSpecificitySequence (5′-3′)Target RNAPositiona (nucleotide range)FISH (FA)bSlot blot Td (°C)cSource or reference
UNI1390Universal—all organismsGACGGGCGGTGTGTACAA16S, 18S1390–1407NU44* 72
ARCH915 Archaea GTGCTCCCCCGCCAATTCCT16S915–9353556* 2
EUK1379 Eucarya TACAAAGGGCAGGGAC18S1379–1394NU42* 28
EUB338 Bacteria GCTGCCTCCCGTAGGAGT16S338–3551054* 1
NON338Negative controlACTCCTACGGGAGGCAGC16S338–35510NU 69
GP1199Most gram-positive bacteriaAAGGGGCATGATG16S1199–121134* B. J. MacGregor et al.d
GAM42aγ-ProteobacteriaGCCTTCCCACATCGTTT23S1027–10433560 40
BET42aβ-ProteobacteriaGCCTTCCCACTTCGTTT23S1027–1043NU58 40
PLA886 Planctomycetales, someEucarya GCCTTGCGACCATACTCCC16S886–9043562 46
CF319a Cytophaga-FlavobacteriumclusterTGGTCCGTGTCTCAGTAC16S319–3363556 39
GAM66016S rDNA clone sequences affiliated with endosymbionts and some other species in the γ-proteobacteriaTCCACTTCCCTCTAC16S660–67435–4052This study
  • a Position in the 16S or 23S rRNA ofE. coli.

  • b FA, formamide concentrations in the hybridization buffer calculated as the percent (vol/vol). NU, not used.

  • c *, Dissociation temperatures (T d) were determined with the washing buffer containing 1× SSC and 1% SDS.

  • d B. J. MacGregor, S. Toze, E. W. Alm, R. Sharp, C. J. Ziemer, and D. A. Stahl, submitted for publication.