Table 2.

Nucleotide sequences of oligonucleotide primers used in PCR assays for gentamicin, kanamycin, apramycin, and streptomycin resistance genes

GeneResistanceAccesion no.Primersa
aac(3)-IaGentamicinU90945F, TTGATCTTTTCGGTCGTGAGT
R, TAAGCCGCGAGAGCGCCAACA
aacC1GentamicinU12338F, ATGTTACGCAGCAGCAACGAT
R, TAAGCCGCGAGAGCGCCAACA
aac(6′)-IbGentamicinU90945F, GTTACTGGCGAATGCATCACA
R, TGTTTGAACCATGTACACGGC
aadBGentamicinAF078527F, GAGCGAAATCTGCCGCTCTGG
R, CTGTTACAACGGACTGGCCGC
aaC3GentamicinX55652F, AAACTGGTGGCAATAGAAGGAT
R, CTATCCGTATGACGCTGAGTC
grmGentamicinM55521F, AAGCGCACGAAGCGCGGGCTG
R, AAGGCGGGCCTCAAGGAGGTC
aacC2GentamicinX51534F, GGCAATAACGGAGGCAATTCGA
R, CTCGATGGCGACCGAGCTTCA
aacA-aphDGentamicinM18086F, AGCCAAATTATTGGAGTAAAGGAA
R, AACTGGCAATATCTCGTTTTA
aph(2")-IdGentamicinAF016483F, CAATACAATAGAGATTTCAGGAG
R, ATGCTTCTGATTTCATTTAATCCC
aadDKanamycinAF051917F, ATATTGGATAAATATGGGGAT
R, TCCACCTTCCACTCACCGGTT
aphA-3KanamycinU51474F, CTGTTCCAAAGGTCCTGCACT
R, CAATTCGGCTAAGCGGCTGTC
aphA/aph(3′)-IdKanamycinZ48231F, ATGGGCGCCTATCACAATTGG
R, TCGCCTCCAGCTCTTCGTAGA
aphA-7KanamycinM29953F, GGAAACACATAGATTGCTTTA
R, CTCCACATCTTGCCAAATCAT
aphAI-IABKanamycinAF093572F, AAACGTCTTGCTCGAGGC
R, CAAACCGTTATTCATTCGTGA
KnKanamycinU66885F, ACTGGCTGCTATTGGGCGA
R, CGTCAAGAAGGCGATAGAAGG
KanKanamycinK02552F, GTGTTTATGGCTCTCTTGGTC
R, CCGTGTCGTTCTGTCCACTCC
kamBApramycinM64625F, TGCCCAACCTGCTGTACCTGT
R, CCCCACGACGGCAGCTGCGGT
kamCApramycinM64626F, TGCGCCGAACCTGCTCTCTGCGT
R, AAGTACCGCGCCTCCTCCA
aacC4ApramycinAJ009820F, ACTGAGCATGACCTTGCGATGCTCTA
R, TACCTTGCCTCTCAAACCCCGCTT
kamAApramycinD13170F, AGGACCCAGGCGGCCA
R, ATCGAGGACACCCGCATCCAC
aadA2StreptomycinAF071555F, CGGTGACCATCGAAATTTCG
R, CTATAGCGCGGAGCGTCTCGC
  • a F, forward; R, reverse.