Table 1.

PCR primers for detection of rumen bacteria

Target bacteriumStrainPrimerAnnealing temp (C)Product size (bp)
ForwardReverse
Prevotella ruminicola ATCC 19189T GGTTATCTTGAGTGAGTTCTGATGGCAACTAAAGAA53485
Prevotella bryantii B14T ACTGCAGCGCGAACTGTCAGAACCTTACGGTGGCAGTGTCTC68540
Prevotella albensis M384T CAGACGGCATCAGACGAGGAGATGCAGCACCTTCACAGGAGC68861
Fibrobacter succinogenes ATCC 19169T GGTATGGGATGAGCTTGCGCCTGCCCCTGAACTATC62445
Ruminobacter amylophilus ATCC 29744T CAACCAGTCGCATTCAGACACTACTCATGGCAACAT57642
Selenomonas ruminantium- Mitsuokella multiacida JCM6582T TGCTAATACCGAATGTTGTCCTGCACTCAAGAAAGA53513
Streptococcus bovis JCM5802T CTAATACCGCATAACAGCATAGAAACTTCCTATCTCTAGG57869
Treponema bryantii ATCC 33254T AGTCGAGCGGTAAGATTGCAAAGCGTTTCTCTCACT57421
Eubacterium ruminantium ATCC 17233T GCTTCTGAAGAATCATTTGAAGTCGTGCCTCAGTGTCAGTGT57671
Anaerovibrio lipolytica ATCC 33276T TGGGTGTTAGAAATGGATTCCTCTCCTGCACTCAAGAATT57597
Succinivibrio dextrinosolvens ATCC 19716T TGGGAAGCTACCTGATAGAGCCTTCAGAGAGGTTCTCACT57854
Ruminococcus flavefaciens ATCC 19208T GGACGATAATGACGGTACTTGCAATCYGAACTGGGACAAT62835