Table 2.

Oligonucleotides and PCR primers for virulence factor targets

Target geneGenBank accession no.PCR product size (bp)Primer sequences for PCR amplificationaOligonucleotide targets adsorbed to array chipbAnnealing temp (°C)
rfbEAF061251292L, TGTCCATTTATACGGACATCCATGGGTTGTCACGAATGACAAAAC50
R, CCTATAACGTCATGCCAATATTGCCCTATTACTACAGGTGAAGGTG50
fliCAF169323625L, GCGCTGTCGAGTTCTATCGAGCAACGGTTAGCAATCGCCTGA52
R, CAACGGTGACTTATCGCCATTCCCGTCATCCTTCGCGCTGTTA54
eaeAAF081184368L, GACTGTCGATGCATCAGGCAAAGGCCTATTATGCTGATGCTATG50
R, TTGGAGTATTAACATTAACCCCAGGGTTCTATGAACTCAATAACTGCTTGG55
slt-IL04539210L, TGTAACTGGAAAGGTGGAGTATACGGATGACGTAACCATTAAAACT49
R, GCTATTCTGAGTCAACGAAAAATAACCTAATGCCTGTCATAATGGAGG53
slt-IIX65949484L, GTTTTTCTTCGGTATCCTATTCCGTCAGTCGTCACTCACTGGTT52
R, GATGCATCTCTGGTCATTGTATTACCTGGAACGTTCCGGAATGCAA54
ipaHM76445269L, CCACTGAGAGCTGTGAGGACGTGGATGAGATAGAAGTCTACC53
R, ATGGCGTGTCGGGAGTGACAGACCATGCTCGCAGAGAAACT54
  • a L, left; R, right.

  • b Oligonucleotide sequences are independent sequences corresponding to the top and bottom spots in each set of rows in Fig. 3.