Table 1.

Strains, oligonucleotides, and plasmids used in this study

E. faecalis strain, oligonucleotide, or plasmidRelevant characteristicsPosition (nucleotides)aStrandSource or reference
E. faecalisstrains
 54 esp +, strong biofilm formingCUNb
 54M54 esp::pBT2 (Cmr)This study
 1 esp +, strong biofilm formingCUN
 1M1 esp::pBT2 (Cmr)This study
 11279 esp +, medium biofilm formingCUN
 11279M11279esp::pBT2 (Cmr)This study
 11262 esp +, weak biofilm formingCUN
 11262M11262esp::pBT2 (Cmr)This study
 14377 esp +, adherence++, the esp gene contains one A repeat and four C repeatsThis study
 23 esp−, non-biofilm forming (Cms)CUN
 23C23 containing pTA2 (Cmr)This study
Oligonucleotides
esp11TTGCTAATGCTAGTCCACGACC1217–1238+43
esp12GCGTCAACACTTGCATTGCCGAA2171–214943
esp46TTACCAAGATGGTTCTGTAGGCAC2256–2279+43
esp47CCAAGTATACTTAGCATCTTTTGG3169–319243
esp2CAGATGGATCATCTGATGAAGT3254–3275+43
esp5GTAACGTTACTGTTACATCTGC5338–535943
esp3SCGCCTTGGTATGCTAAC1004–1020+This study
esp4SGGTAAGCTTACGCCGT2435–2420This study
esp2SGGGTCGACACTTCTATTCATCCTCT5707–5691This study
 pbacSc GCTTGCATCAAAATAAACTACATGGGTATAATAGCAATGAAATGCATTTCAAAAATATTTTGAGGAGAATTTAGTATGTTTGGAAAA+This study
Plasmids
 pCU1 E. coli-S. aureus shuttle vector3
 pBT2 E. coli-S. aureus shuttle vector with a thermosensitive origin of replication for S. aureus 5
 pTA1Vector for recombination experiments, 0.95-kb PCR fragment of espsubcloned in pBT2This study
 pTA2Vector for complementation experiments; a 4.3-kb PCR fragment containingesp from E. faecalis 14377 fused with the enterococcal constitutive bacA promoter cloned in pCU1This study
  • a Nucleotide sequence positions refer to the esp sequence in the GenBank database under accession no.AF034779.

  • b CUN, University Clinics of Navarra.

  • c Regions -35 and -10 and the ribosome binding site from the bacA promoter according to Fujimoto et al. (15) are underlined. The ATG codon for the first amino acid of Esp is also underlined.