Table 1.

Bacterial strains and primers used in this study

Strain or primerDescriptionSource or reference
S. pneumoniae
 CP1200Rx derivative; hex mal rpsL1; Hex+ KnsRecA+ Smr 14
 CP1250CP1200 butbgl-1; Kns Smr 16
 CP1296CP1250 butcbp3::kan-rpsL + (by transformation with PCR construct; see Materials and Methods); Knr Sms This study
 CP1326CP1296 but rpsL +/+ by spontaneous conversion;cbp3::kan-rpsL +; Knr Sms This study
 R800R6 derivative; Hex+ Kns RecA+Sms 11
 R239R800 butrecA::ermAM (by transformation with a ligation mixture)-deletion ClaI (recA)-ClaI (within RUP, downstream ofrecA), blunt ended and ligated to aBstUI-ermAM fragment; Eryr Bernard Martin
 R304R800 but nov1 rif23 rpsL41; Novr Rifr Smr 15
 R416R800 but rpsL41 (by transformation with R304 chromosomal DNA); Smr This study
 R810R800 butcomC::pXF520 (comC +)ebg::spc, and carries UP mutation; ComCDEUP Cmr Spcr 12
 R960R416 butcbp3::kan-rpsL + (by transformation with CP1296 chromosomal DNA); Hex+ rpsL41 Knr Sms This study
 R961R800 butcbp3::kan-rpsL + (by transformation with CP1296 chromosomal DNA); Hex+Knr This study
 R974R960 but Smrthrough spontaneous conversion;cbp3::kan-rpsL41 rpsL41; Knr Smr This study
 R981R800 butrpsL1 (by transformation with CP1200 chromosomal DNA); Smr This study
 R989R960 butrecA::ermAM (by transformation with R239 chromosomal DNA);cbp3::kan-rpsL +Hex+ rpsL41; Eryr KnrSms This study
 R990R981 butcbp3::kan-rpsL + (by transformation with CP1296 chromosomal DNA); rpsL1; Knr Sms This study
 R1001R989 but spontaneous revertant to Smr;cbp3::kan-rpsL 0 recA::ermAM rpsL41; EryrKnr Smr This study
 R1004R960 buthexA::cat; CmrKnr Sms This study
 R1005R990 buthexA::cat; CmrKnr Sms This study
 R1029R800 but ΔcomC::kan-rpsL + (by transformation with a SOEing fragment; see Materials and Methods); Knr This study
 R1036R981 but ΔcomC::kan-rpsL + (by transformation with R1029 chromosomal DNA); KnrSms This study
Primersa
 B CATTATCCATTAAAAATCAAACGGAAGCCGGGAAAATTCCCAGC (underlined sequence corresponding to kan cassette; complementary to Kan5, see below); upstream of comC; 679–660; SPU33315
 BM47GATTTGCTAAGTTTGAAATGATTGAG; withinorfL, upstream of comCDE; 3–28; SPU33315
 BM52GTCCTCTATCCCTCTCATAC; within comD; 1080–1061; SPU33315
 BM54CATTCCAGCATAATCATGTCG; withincomD; 1583–1563; SPU33315
 BM81TCGCGATGACTACTATGAACG; upstream ofcbp3; TIGRb
 BM82GCTTACAGAAAAGAGCAGGAAAT; downstream of cbp3; TIGR
 C GGAAAGGGGCCCAGGTCTCTGTAATGAAATAAGGGGAAAGAG (underlined sequence corresponding to rpsL; complementary to primer 7, see below); upstream of comD; 801–822; SPU33315
 cat3AGCCAGTCATTAGGCCTATC; within cat(pC194 plasmid); 1903–1884; L08860
 DAM301CGCGCAAGCTGGGGATCCG; upstream of kan in pR410
 DAM303AAGGGCCCGTTTGATTTTTAATG; positions 7–23 of DAM303 correspond to positions 773–789 upstream of kan;AF411920; TIGR
 DAM313AGCTTTCTCGTGGTGTAGAACAAC; upstream ofcbp3; TIGR
 DAM314ACGAGGATCCGATCCATTTCCTCTGGAATA; within cbp3; TIGR
 DAM315AGCAGGGCCCAGGTCTCTGGTAAGTGGTAT; within cbp3; TIGR
 DAM316CTCTCAAGGTCGCCCAGCTATG; downstream ofcbp3; TIGR
 DAM345CAGGAGACATTCCTTCCGTATCTT; withinkan; 926–903; AF411920; TIGR
 DAM347CCGAATTCTAGGTACTAAAACAATTCATCCAGTAA; downstream of Kan5 in pR410
 DAM350CTGGAATTCACCAAAAATAAAAAAACACAG GAG; upstream of rpsL; TIGR
 DAM351CTAGGGCCCCTTTCCTTATGCTTTTGGAC; downsteam ofrpsL; TIGR
 Kan5CCGTTTGATTTTTAATGGATAATG; positions 3–24 of Kan5 correspond to positions 185–206 of ami;X17337
 7AGAGACCTGGGCCCCTTTCC; downstream ofrpsL; TIGR
  • a Information given in the order sequence; gene; position within the deposited sequence indicated; and GenBank/EMBL accession number.

  • b TIGR, TIGR website (http://www.tigr.org).