Table 1.

Oligonucleotide primers used in this study

PrimerSequence (5′ to 3′)Amino acid sequenceApplication
nas22TGYCCNTAYTGYGGNGTCPYCG nasA/narBPCR amplification
nas964CARCCNAAYGCNATGGGQPNAM nasA/narBPCR amplification
nasA1735ATNGTRTGCCAYTGRTCDQWHT nasAPCR amplification
nas1933CARTGCATNGGNAYRAAF/L V/I/M PMH nasA/narB PCR amplification
fd1AGAGTTTGATCCTGGCTCAG16S rRNA forward primer
rp2ACGGCTACCTTGTTACGACTT16S rRNA reverse primer
M13FGTAAAACGACGGCCAGForward sequencing primer, M13 vector
522FCAGCCGCGGTAATACForward sequencing primer, 16S rRNA
1056FTGGCTGTCGTCAGCTCGTGTForward sequencing primer, 16S rRNA
M13RCAGGAAACAGCTATGACReverse sequencing primer, M13 vector
1056RACACGAGCTGACGACAGCCAReverse sequencing primer, 16S rRNA
522RGTATTACCGCGGCTGReverse sequencing primer, 16S rRNA