TABLE 1.

PCR primers and probes

GeneTargeted regiona (bp)NameSequence (5′ to 3′)Annealing temp (°C)Product size (bp)
LTIIa697-714LTIIa-FGGTGTGCATTTCAGCGAC61358
1035-1054LTIIa-RTGGTATATTCCGGGTGGACG
815-834IC-FGCATGGAGAAAGAGATGAGC56204
999-1019IC-RCTTACCACATAGATCCCACG
STII470-494STIIO-FGCATCTATGTTCGTTTTTTCTATTG57173
625-642STIIO-RGCAACCATTATTTGGGCG
502-521STII-FTGCCTATGCATCTACACAAT47113
595-614STII-RTAGAGATGGTACTGCTGGAG
LTIIa862-899prLTIIaCTGATGACTGGCATTCTGTCTGGTCAGGTATATGCTGG5838
STII533-566prSTIIGATCTGTGTGAACATTATAGACAAATAGCCAAGG5834
  • a Referenced from GenBank accession numbers M17894 (LTIIa) and M35586 (STII). F, forward primer; R, reverse primer.