TABLE 2.

Oligonucleotide primers used

PrimerSequence (5′-3′)aRelevant propertiesb
HvLeuFCGCCGGCGACCACGTCAAAGAAGAleuB probe, forward primer
HvLeuRAGCAGCATCGCCGCGGACAGAATCleuB probe, reverse primer
TrpAF2CGCCGAGGGGCCGACCATCCtrpA probe, forward primer
TrpARCGTTGCGACGCGCCCGCTACCtrpA probe, reverse primer
dLeu5FGCGTTCAGCACGAATTCCGCCGCCGGGATGACCTleuB deletion, upstream internal primer, EcoRI deletion site
dLeu5RCGCGGGATCCGTCAACCCCGACGAGACCACCTACGAleuB deletion, upstream external primer, BamHI cloning site
dLeu3FGCACGGATCCGCGGGCCGTTGTGATTGAGTleuB deletion, downstream external primer, BamHI cloning site
dLeu3RGGCGGAATTCGTTTCGAACGCGCCCGTTTTCGTTTCTGATleuB deletion, downstream internal primer, EcoRI deletion site
dTrp5FGCTCTAGAACGCGCTCGGGCAGGTCTTACTGGtrpA deletion, upstream external primer, XbaI cloning site
dTrp5RGGACGAATTCCGGGCCGTCGGAGAAGGtrpA deletion, upstream internal primer, EcoRI deletion site
dTrp3F2CGAACTCGAATTCGGTGCGGTAGCGtrpA deletion, downstream internal primer, EcoRI deletion site
dTrp3RCCGGTGAGTCTCTAGACGTTTTCGTCCGtrpA deletion, downstream external primer, XbaI cloning site
TrpPciGCCTGACATGTCGCTCGAAGACGCCtrpA coding sequence, forward primer, PciI site
TrpXbaGGGTTCTAGAGCAGTTATGTGCGTTCCtrpA coding sequence, reverse primer, XbaI site
LeuBspGCCCTACGTTCATGACTGAGGAAATCGleuB coding sequence, forward primer, BspHI site
LeuXbaCGGGTCGCTCTAGATCAGAGTCGGTCGleuB coding sequence, reverse primer, XbaI site
LhrF2GAAGCTGAAGGCGGGCGAGTTACGlhr probe, forward primer
LhrR2ATGGCGGCGAGGTTCAGTTTGTCTlhr probe, reverse primer
dHdrBF2CCCGATCTAGAGCCGGCTGGTCATChdrB deletion, upstream external primer, XbaI cloning site
dHdrB5RCCCAGAAAGCTGCTAGCCGCTCATTCGhdrB deletion, upstream internal primer, NheI deletion site
dHdrB3FCTCGGGCTAGCGGGAGTACAAAATCGTChdrB deletion, downstream internal primer, NheI deletion site
dHdrB3RGCCAAGCTCGAAATTAACCCTCAChdrB deletion, downstream external primer (XbaI site used)
dLhr5FGAGCGCGCGTAATACGACTCACTlhr deletion, upstream external primer (XhoI site used)
dLhr5RGCGCGTCGCGGCCGCAATCAACGACGlhr deletion, upstream internal primer, NotI deletion site
dLhr3FGCGAGCGGCCGCGCCGGGTCATTACClhr deletion, downstream internal primer, NotI deletion site
dLhr3RCGCGCAATTAACCCTCACTAAAGGGlhr deletion, downstream external primer (XhoI site used)
HdrBspTGGCCTCATGAGCGGCGAGGAGChdrB coding sequence, forward primer, BspHI site
HdrXbaCTCCCACTCTCTAGAGTTACTCATCGGhdrB coding sequence, reverse primer, XbaI site
  • a Restriction endonuclease sites used in cloning are underlined.

  • b Deletion sites were used to ligate flanking sequences. Cloning sites were used to clone deletion constructs in plasmid vectors. Cloning sites in parentheses were located in the amplified sequence (not the primer).