TABLE 2.

Plasmids and primers used in this study

Plasmid or primerDescription and/or construction or primer sequenceReference or source or added site
Plasmids
    pJK41AmpR, PurR cloning vector, oriR6K replicon19
    pWM241pC2A replicon cloned into pBluescript SK20
    pWM368 M. barkeri Fusaro mcrB promoter source39
    pWM369 M. barkeri Fusaro serC promoter source39
    pWM370 M. barkeri Fusaro orf2 promoter source39
    pCK12 M. acetivorans C2A proC plasmid40
    pMP29 NdeI/KpnI-cut hpt PCR product (using primers NdeI-apt and ApaIKpnIap) cloned into NdeI/KpnI-cut pWM368This study
    pMP33 AflII/XhoI-cut up-hpt PCR fragment (using primers AflIIaphpt and SacI-aphpt) cloned into AflII/XhoI-cut pJK41This study
    pMP42 BglII/BamHI-cut dn-hpt PCR fragment (using primers BglIIdnapt and BamHIdnapt) cloned into BglII/BamHI-cut pMP33This study
    pMP44762-bp SphI/ApaI fragment of pMP29 cloned in SphI/ApaI-cut pJK41This study
    pMP45 NdeI/BglII-cut uidA PCR product (using primers uidA (NdeI) and uidA(Bgl2)) cloned into NdeI/BglII-cut pWM368This study
    pJK81 NdeI/BglII uidA fragment from pMP45 cloned into NdeI-BamHI-cut pWM368This study
    pJK82 NdeI/BglII uidA fragment from pMP45 cloned into NdeI-BamHI-cut pWM369This study
    pJK83 NdeI/BglII uidA fragment from pMP45 cloned into NdeI-BamHI-cut pWM370This study
    pMP62 BamHI-cut/T4 DNA polymerase-treated proC fragment from pCK12 cloned into AflII-cut/T4 DNA polymerase-treated pMP44This study
    pMP69 SpeI/MluI-cut up-proC PCR product (using primers SpeI-proB and MluI-proB) and MluI/KpnI-cut dn-proC PCR product (using primers MluI-proC and KpnI-proC) cloned into SpeI/KpnI-cut pMP44This study
    pJK84 BglII-cut pMP62 treated with T4 DNA pol and dNTPs then religatedThis study
    pJK85 SphI-Ecl136II mcrBp-uidA fragment of pJK81 cloned into BglII-cut/T4 DNA Pol-treated/SphI-cut pMP62This study
    pJK86 SphI-Ecl136II serCp-uidA fragment of pJK82 cloned into BglII-cut/T4 DNA Pol-treated/SphI-cut pMP62This study
    pJK87 SphI-Ecl136II orf2p-uidA fragment of pJK83 cloned into BglII-cut/T4 DNA Pol-treated/SphI-cut pMP62This study
    pJK88 NdeI/BamHI-cut E. coli proC PCR fragment (using primers procF and procR) cloned into NdeI/BamHI-cut pWM369This study
    pJK89 SpeI fragment of pWM241 with pC2A replicon cloned into XbaI-cut pJK88This study
Primers
    NdeI-aptCCGCCGCATATGCTTGAAAGACTGAAAGACTACATGG NdeI
    ApaIKpnIapCCGCCGGGTACCGGGCCCTCACTGATCCCCAAAGACATCC KpnI, ApaI
    AflIIupaptCCGCCGCTTAAGCCACTCCCGGAACAGAGG AflII
    SacI-upaptCCGCCGCTCGAGTTTGGCGGTTTCAATATTCC XhoI
    BglIIdnaptGGGGGGAGATCTCATATGTCTTTGGGGATCAGTGAAGC BglII
    BamHIdnaptGGGGGGGGATCCCACCAGAGACTTTGCAATTACC BamHI
    uidA(NdeI)GGGGGGCATATGTTACGTCCTGTAGAAACCC NdeI
    uidA(Bgl2)GGGGGGAGATCTGATCATTAACGGCGCAGTACCG BglII
    SpeI-proBGCCGCCACTAGTTTAGTTCGGGAGCAATAGGC SpeI
    MluI-proBGCCGCCACGGCTTTAGTTTATCCCTTCCAGTAT MluI
    MluI-proCGCCGCCACGGCTCGATTCCTTTTTAC MluI
    KpnI-proCGCCGCCGGTACCACTGGTTCCGCCTGAAA KpnI
    procFGCGCGCCATATGGAAAAGAAAATCGGTTTTATTGG NdeI
    procRGCGCGCGGATCCGACGTAACCGCACCGAAGTG BamHI