TABLE 1.

Primers used for PCR and sequencing

GeneLocationaPrimerbAnnealing temp (°C)Sequence lengthc (bp)
gyrB 6,056-6,747f-5′ACAAGAAAATGCTTCAGATT3′49627
r-5′GCTCCACGTAAGAACGA3′
hisJ 607,296-607,939f-5′AAAAATAGTTGCTTATGG3′45530
r-5′GCTGAAACTTCTGACAC3′
cbiE 1,220,918-1,221,483f-5′GATTGGACCAGGAGAT3′49537
r-5′CAATCACCACTACATTCA3′
rnhB 1,296,153-1,296,484f-5′GCTATCGGAGTAGGG3′47275
r-5′CCAATTGTATCTAAACCA3′
truB 1,356,774-1,357,734f-5′CGGCATTATCCCACT3′47800
r-5′AAATTCGAATTCCTCTCA3′
ribC 1,357,735-1,358,785f-5′AGAGGAGAAGTGGCAAAA3′51885
r-5′GGTGAGTCGCAAAAGC3′
comEA 1,518,181-1,518,790f-5′ACTCCCTTATGATTTGAT3′47482
r-5′TGTGCTGGTTTAGTTTAT3′
purM 1,838,742-1,839,645f-5′CTGCCAACACCATACCAA3′54720
r-5′AGTAAAGCAGGCGTGGAC3′
aroE 1,999,439-1,998,282f-5′AATAAACAAGGGCTGGTT3′49951
r-5′CATCATGCCAATACGG3′
hisC 2,000,571-2,001,623f-5′TTCAAAAACGCCTCCAA3′48809
r-5′CGCGAAGAAGAAGTGATG3′
addB 2,358,489-2,359,819f-5′TCTTTTTCCCATTTCCAT3′471,048
r-5′CATATGTTCGGTGGTGAG3′
  • a Location of primer as annotated for the L. monocytogenes EGD genome (6).

  • b f, forward primer; r, reverse primer.

  • c Length of analyzed sequence; the PCR product is longer.