TABLE 3.

Primers used in this study

PrimerSequence (5′-3′)aRestric- tion site
GFP5′GTCGCCGTGCACGTGAGCAAGGGCGAGGA GCTGAlw44I
GFP3′CTAGAGACGCGTCCGCTTTACTTGTACAGCMluI
pepIMut 5′TAAGGGATCCATAAGATTATCTAAATATAT TTAA AAAGBamHI
ptxpepI 3′ACATAGTGCACTTTATCTTTTTTGTTGCTATT TAAlw44I
pepIMut 5′TAAGGGATCCATAAGATTATCTAAATATATT TAAAAAGBamHI
3′pepI63bGTTTATCGTGCACGTTGCTATTTATTCTTTTT TCAlw44I
3′pepI57bATTTGTGCACACTTAATTTCGTTGAATAATCGAlw44I
3′pepI53bTTCTGTGCACATATTTTTTATCACTTAATTTCG TTGAlw44I
  • a Restriction sites in the primer sequence are underlined. Mutations in the primer sequence are marked in boldface.

  • b The number to the right of “pepI” indicates the amino acid number of PepI.