TABLE 1.

Bacterial strains, plasmids, and primers

Strain, plasmid, or primerDescriptionSource or reference
Strains
    E. coli S17-1thi pro hsdR recA with RP4-2 (Tc::Mu, Km::Tn7)39
    M. gryphiswaldense MSR-1 DSMZ 6361Wild type30
    M. gryphiswaldense R3/S1Rifr, Smr spontaneous mutantThis work
    M. gryphiswaldense Da136M. gryphiswaldense ΔflaAThis work
Plasmids
    pK19mobsacBKmr, sacB modified from B. subtilis, lacZα27
    pBBR1MCS2Kmr, lacZα17
    pBBR1MCS5Gmr, lacZα17
    pGEM-T EasyAmpr, lacZα, PCR cloning vectorPromega
    pDa87pGEM-T Easy, containing a 2.5-kb PCR fragment with the flaA gene of M. gryphiswaldenseThis work
    pDa102pGEM-T Easy, containing a PCR fragment with PstI linker and the Gmr of pBBR1MCS5This work
    pDa103pK19mobsacB, containing the 2.5-kb fragment with the flaA geneThis work
    pDa115pDa103 with Gmr insertion in the PstI cutting site (flaA::Gm)This work
    pDa116pK19mobGII with EcoRI fragment containing flaA::GmThis work
Primersa
    MCS5foPstICTGCAGGACGCACACCGTGGAAA
    MCS5rwPstICTGCAGGCGGCGTTGTGACAATTT
    flaAUp3TTGTCGGGGAAACGGAAGC
    flaALo3CATCAGCCGCCAGAAAGGAC
    flaRTfoTAGCGACTTGACCACCCGTAAG
    flaRTrwACCTTCCTTCAGAGCGTTCACG
    SondeflAfo2GCTTCACCTATGGTGCCGC
    SondeflArw2GCCGTCATACCCACGAAAGC
  • a Sequence 5′ to 3′. PstI restriction sites are underlined.