TABLE 2.

Primers used for PCR amplification

ORFInternal primersaExternal primersb
La57Forward GATCTCTAGA-CCAGCAATCCAGTTForward GCATGCCAGCGATAAAGAAT
Reverse GATCAGATCT-CTACACCGCTGATGReverse AAGGTGGTTCGCTCAGAAAT
La867Forward GATCTCTAGA-ATATTGCGGTTGGForward GCACCTCAACAAAGTGATCAG
Reverse GATCAGATCT-AGTGGGAAACATCGReverse AAAGGCCCTTAGATGGAAC
La996Forward GATCTCTAGA-AGCCTGAGCCATACForward ACAGTGTAGCCCTTGTAG
Reverse GATCAGATCT-AGCGATACCGTTCCReverse CCATACTTGGAGGAGAAC
La995Forward GATCTCTAGA-TGCTGCGCCTTACAForward AGTTGGCCAGTCATTGCT
Reverse GATCAGATCT-TAGGGCACCCGTTCReverse TCGCCAAGATCACGAAGA
  • a Primer sets used to amplify the internal region for gene inactivation.

  • b Primer sets used to amplify junction fragments.