TABLE 2.

16S rRNA gene-targeted group-specific primers used in this study

Target bacterial groupPrimerSequenceSize (bp)aAnnealing temp (°C)Reference
Clostridium coccoides groupg-Ccoc-FAAATGACGGTACCTGACTAA4405018
g-Ccoc-RCTTTGAGTTTCATTCTTGCGAA
Clostridium leptum subgroupsg-Clept-FGCACAAGCAGTGGAGT23950This study
sg-Clept-R3CTTCCTCCGTTTTGTCAA
Bacteroides fragilis groupg-Bfra-FATAGCCTTTCGAAAGRAAGAT4955018
g-Bfra-RCCAGTATCAACTGCAATTTTA
Bifidobacteriumg-Bifid-FCTCCTGGAAACGGGTGG5505518
g-Bifid-RGGTGTTCTTCCCGATATCTACA
Atopobium clusterc-Atopo-FGGGTTGAGAGACCGACC19055This study
c-Atopo-RCGGRGCTTCTTCTGCAGG
Prevotellag-Prevo-FCACRGTAAACGATGGATGCC5135518
g-Prevo-RGGTCGGGTTGCAGACC5135518
  • a DNAs extracted from Ruminococcus productus YIT 6141T, Faecalibacterium prausnitzii YIT 6174, Bacteroides vulgatus YIT 6159T, Bifidobacterium longum YIT 4021T, Collinsella aerofaciens ATCC 25986T, and Prevotella melaninogenica YIT 6039T were used as real-time PCR controls.