TABLE 1.

Primers used for PCR diagnosis

VirusForward primerReverse primerLength (bp)aReference
DWVTTTGCAAGATGCTGTATGTGGGTCGTGCAGCTCGATAGGAT39530
SBVGGATGAAAGGAAATTACCAGCCACTAGGTGATCCACACT426
CBPVAGTTGTCATGGTTAACAGGATACGAGTCTAATCTTAGCACGAAAGCCGAG45527
ABPVTGAGAACACCTGTAATGTGGACCAGAGGGTTGACTGTGTG452
BQCVGGACGAAAGGAAGCCTAAACACTAGGAAGAGACTTGCACC424
KBVGATGAACGTCGACCTATTGATGTGGGTTGGCTATGAGTCA39329
TMVbAAAAACAGTCCCCAACTTCCAAGGAGGATTCTCTCGCTGT600
  • a Length of DNA fragment amplified.

  • b TMV, tobacco mosaic virus.