TABLE 2.

Primers used for MLST of O. oeni strains

ProteinAccession no.aGenePrimersSequence 5′→3′5′ start positionaPCR product length (bp)Accession no.
B subunit of DNA gyraseZP_00069208gyrBGYRB1TGGGCTTCATGGTGTTGGC375947AJ618989-AJ618996
GYRB2CCCTCGACGATAAACAATTC1322
d-Alanine-d-alanine ligaseZP_00069716ddlDDL1CGATGTTAGCAAGCGTTCG54911AJ618997-AJ619006
DDL2TTCGTATTTCCCGGTAGTG965
PhosphoglucomutaseZP_00070472pgmPGM1CATCCGACTCCGGAATTGAC370826AJ619007-AJ619018
PGM2CCGTAGGATTCTTCAAAACC1196
TransketolaseZP_00069744recPRECP1GGCGATGGGGACTTAATGG550926AJ619666-AJ619673
RECP2CCCGTCTTCGCCGACAGC1476
Malolactic enzymeZP_00069821mleAOO1bGTGCCGCTTTTTTGGATATTA332430AJ619674-AJ619675
OO2bAGCAATTTTATCTTTATAGCT762