TABLE 1.

Bacterial strains, plasmids and oligonucleotides used in this study

Strain, plasmid, or oligonucleotideRelevant characteristicsa or sequence (5′ → 3′)Reference or source
Strains
    P. fluorescens
        CHA0Wild type48
        CHA19ΔgacS50
        CHA630phlH::Tn5; Kmr39
        CHA631ΔphlA39
        CHA638phlF::ΩKm; Kmr39
        CHA1091ΔphlGThis study
        CHA1092ΔphlA ΔphlGThis study
        CHA1094CHA1092::attTn7-phlG+; GmrThis study
    E. coli
        BL21(DE3)F ompT hsdSB(rB mB)gal dcm (λDE3)Novagen
        DH5α and HB101Laboratory strains35
Plasmids
    peT28aExpression vector designed to produce His6 tag fusionsNovagen
    pME497Mobilizing plasmid; IncP-1, Tra; RepA(Ts); Apr48
    pME3087Suicide vector; ColE1 replicon; RK2-Mob; Tcr48
    pME6010Cloning vector; pACYCI77-pVS1 shuttle vector; Tcr18
    pME6015Cloning vectors for construction of translational lacZ-fusions; derived from pME6010; Tcr39
    pME6182Carrier plasmid for Tn7 containing the mini-Tn7-Gm transposon; Apr Gmr31
    pME6259phlA′-′lacZ fusion; Tcr39
    pME8019pUK21 carrying a 1,200-bp EcoRI-HindIII insert with a deletion in phlG; KmrThis study
    pME8020pME3087 carrying a 1,200-bp EcoRI-HindIII insert with a deletion in phlG; TcrThis study
    pME8030pME6015 with a 226-bp phlG upstream fragment and a translational phlG′-′lacZ fusion containing the first 83 phlG codons; TcrThis study
    pME8031pME6015 with a 495-bp phlG upstream fragment and a translational phlG′-′lacZ fusion containing the first 83 phlG codons; TcrThis study
    pME8032peT28a containing the phlG gene flanked by a C-terminal His6 tag under the control of the T7 promoter; TcrThis study
    pME8039pME6182 with a 1,303-bp HindIII fragment containing phlG of CHA0; Apr GmrThis study
    pUK21Cloning vector; lacZα; Kmr47
    pUX-BF13Helper plasmid for Tn7-based transposon mutagenesis containing the transposition functions; R6K-replicon; Apr5
Oligonucleotides
    MBP20GGAATTCGCCATTCTCACTTCCACCATC, EcoRI
    MBP22GCTCTAGAACAGATAGCCGCCATTTCGCT, XbaI
    MBP23CCCAAGCTTCGATAGATCCATGATCTGGCC, HindIII
    MBP26GCTCTAGAGCGGCCTGAAACAACAGCCAT, XbaI
    MBP37GGAATTCTGTTGGCGTACCCCAGCTCAG, EcoRI
    MBP38CGGGATCCGCGATTGATGTCCTCGATGCT, BamHI
    MBP39GCTCTAGAAATAATTTTGTTTTAACTTTAAGAAGGAGATATACCATGGCGGCTATCTGTCAATTCACGCCAAAG, XbaI
    MBP40CCCAAGCTTGGCCGCGGGGGTGCCGAACTC, HindIII
    MBP41GGAATTCGTGACAACAGTTCGCGGGTCA, EcoRI
    MBP52CCCAAGCTTTGCTGGTATCGGCTGTTGACT, HindIII
    MBP53CCCAAGCTTTGTTGGCGTACCCCAGCTCAG, HindIII
  • a Apr, ampicillin resistance; Gmr, gentamicin resistance; Kmr, kanamycin resistance; Tcr, tetracycline resistance. Restriction sites specified for oligonucleotides are underlined.