TABLE 1.

PCR primers and amplification conditions for the genes used in the RT-PCR validation of the long SAGE analysisa

Tag no./genePrimer sequenceAnnealing temp (°C)Amplicon size (bp)
455′GCATCACGTTGACGTAGTCG56.2267
3′GGAGTTCGCCTCACTGATTC
2855′AGCTTGAAGGTCTTGGTGGA63115
3′CGGGCTACTTCATCTTCGAG
121125′GATCATCGAGAGCACACCAA59.5286
3′GATTCCGAAGATGACCCTCA
Type 1 actin (Q41205)5′GATCTGGCACCACACCTTCT55.5116
3′TGATCTGCGTCATCTTCTCG
  • a PCR conditions are given in the text.