TABLE 3.

Successfully annotated differentially expressed (R ≥ 2) SAGE tags

Tag IDaTag sequenceNo. of copiesb in:R valueChange (n-fold)c or result for:Annotation
−N libraryReplete library−P library−N library−P library
1064CATGGGATAATGAAATAGGAC214113732.03−2.094.07Probable 18S rRNA transcript
24856CATGGCGTTAACGGGTAACGG285013726.78−1.913.33Probable 18S rRNA transcript
11533CATGATTTGTCGACCGAAGAT024019.30Uniquely absent24.34Putative fructose-1,6-bisphosphate aldolase
11736CATGCTAATTTTTAAAAGAAA013819.22Uniquely absent46.24Mitochondrial-encoded large-subunit rRNA
24531CATGCAAGTCGAACGAGAGTT063715.45Uniquely absent7.50Plastid-encoded small-subunit rRNA
289CATGCCGACTAGGGATTGGAG20297512.49−1.553.15Probable 18S rRNA transcript
11766CATGGTTGTCGTCAGTTCGTG002111.48NAUniquely presentMitochondrial-encoded large-subunit rRNA
25306CATGGCCGTTCTTAGTTGGTG407110410.68−1.901.78Probable 18S rRNA transcript
2053CATGTTTTCCGTGCCGGTCTG97399.281.206.78Putative chloroplast ferredoxin
25385CATGTTGGCTAGTGTGATCTT814439.09−1.873.74Putative light-harvesting complex protein
285CATGCGCCGATTCGTGCGCAC1247416.92−4.19−0.94Putative fucoxanthin chlorophyll a/c binding protein
24557CATGGATAGTATAGAGAGTCC12165.68−2.149.74Putative polyphosphate synthetase
39CATGATGGCCAAGTAGGCTCC344055.58−1.26−6.57Putative calmodulin
30CATGGCTGCGATGTACGACCC351635.322.05−4.38Putative polyphosphoinositide-binding protein
196CATGGGAGCGCAGGACGGCGC35204.96−1.784.87Putative fucoxanthin chlorophyll a/c binding protein
12215CATGTGGAGTGTCCTCCTTTT0094.92NAUniquely presentPutative enolase (2-phosphoglycerate dehydratase)
12088CATGAATTGGGTTTAAAACGA0094.92NAUniquely presentMitochondrial-encoded large-subunit rRNA
25078CATGTAGAGGTATTCTACACC1120364.81−1.942.19Putative fucoxanthin chlorophyl a/c protein
25102CATGCCCCTTATGCCCTGGGC14154.51−4.274.56Plastid-encoded small-subunit rRNA
3320CATGTGTTGTTGTTTTGGATA314214.44−4.991.83Putative fucoxanthin chlorophyll a/c binding protein
25010CATGGCTGTCGTCAGCTCGTG18164.41−8.552.43Plastid-encoded small-subunit rRNA
12892CATGCAACATTTGTAAAAATG0084.38NAUniquely presentMitochondrial-encoded large-subunit rRNA
25026CATGCTGTGTGAAGGGGCACA410224.28−2.672.68Putative phosphoglycerate kinase
9469CATGCGAGCCTTCTCGTAGGC03114.24Uniquely absent4.46Phosphate-repressible phosphate permease
9481CATGTGTTTTTAATAAACAGT02104.04Uniquely absent6.08Mitochondrial-encoded large-subunit rRNA
25244CATGCAGGAGTTCCCGACTCA1216334.02−1.422.51Probable 18S rRNA transcript
8393CATGCCGATATGTTGTCTGCC1093.94Uniquely absent in repleteUniquely absent in repletePutative 30S ribosomal protein S1
24482CATGGGAGCTGGTCATACCCA03103.80Uniquely absent4.06Plastid-encoded small-subunit rRNA
1484CATGGGCTTCGTCTCGGAGGC412203.55−3.212.03Putative fucoxanthin chlorophyll a/c binding protein
5002CATGTATGTATAAATTACTCG1083.44Uniquely absent in repleteUniquely absent in repletePutative sulfate adenylyltransferase (ATP-sulfurylase)
4313CATGTCGTGTGTTTGTGTCCT2083.07Uniquely absent in repleteUniquely absent in repletePutative chlorophyll a/b binding protein
37CATGTCGTGGCAGGCCTTTGT4524122.931.75−1.64Putative calcium-dependent protein kinase
191CATGGGTGCCGTGCGCCGGGG1740152.89−2.51−2.19Putative ribosomal protein S15
2203CATGGCCTTCGTCTCCGAGTC61102.87−1.96Uniquely absentPutative fucoxanthin chlorophyll a/c binding protein
271CATGTCGCCCTGCCCAGCGCC11802.821.29Uniquely absentSimilarity to a number of hypothetical proteins
10410CATGATTCTTGATCGTGGCGC0052.73NAUniquely presentPutative photosystem II stability/assembly factor HCF136
11952CATGATCAACGAGGTTGACGC0052.73NAUniquely presentPutative calmodulin
255CATGGGGTTTACATATGCACT14412.593.28−3.29Putative P450 protein
639CATGCTCAACGAGGACGAGCT72042.54−3.05−4.11ADP-ribosylation factor
1714CATGGAGTGCGTTTAGCGAGA31212.49−4.27−9.86Putative acetyl-coenzyme A:acetoacetyl-coenzyme A transferase
18CATGATACCCCGTTTGTGCGA4319362.432.122.31Putative nitrate transporter
5573CATGCGATTGTGCGTCAGTGA16102.42−6.412.03Putative RAB11A (member RAS oncogene family)
470CATGTGTGCTCCCGCATACGC6902.35−1.60Uniquely absentPutative Myb-related domain
5434CATGTAGACGCGTCTGTACAG0502.30Uniquely present in repletePutative glutaredoxin-related protein
2558CATGTACCGATCGCCGCTACG67172.30−1.252.96Putative light-harvesting chlorophyll a/b protein of photosystem I
90CATGGATAGAAGAGGCGCTGC3820112.271.78−1.49Possible sterol desaturase-related protein
1848CATGCAAGAGCGACTGCCTGC0462.20Uniquely absent1.83Probable 18S rRNA transcript
12112CATGAGGAGAGCGACACTTTG0042.19NAUniquely presentPutative inorganic pyrophosphatase
12181CATGTCCATCCAGGGCAAGTC0362.18Uniquely absent2.43Putative photosystem I subunit X
1388CATGACCGGGCCGAGAGGGAT5002.16Uniquely presentNAPutative GDP dissociation inhibitor
4062CATGCAGCGCAGCGCGCGTCG1492.15−4.272.74Putative acyl-coenzyme A-desaturase with similarity to 4-methyl-5(B-hydroxyethyl)-thiazole
10890CATGCAGGGTGTCGTGCAGTC0152.02Uniquely absent6.08Monophosphate biosynthesis protein
17129CATGCTCGTCTGCCCGACCGA0152.02Uniquely absent6.08Putative U6 snRNA-associated Sm-like protein LSm7
  • a The tag identification (ID) can be used to view the data on a particular tag at http://gmod.mbl.edu/emiliania_huxleyi.

  • b Raw frequencies in each SAGE library are presented for each tag.

  • c Change (n-fold) includes correction for sampling depth, with negative symbols used for down-regulation. NA, tag was not detected.