TABLE 4.

Differentially (R ≥ 2) expressed tags with the greatest change (n-fold) in the −N and −P libraries

Tag IDaTag sequenceNo. of copiesb in:R valueChange (n-fold)c or result for:Annotationd
−N libraryReplete library−P library−N library−P library
11736CATGCTAATTTTTAAAAGAAA013819.22249452Uniquely absent46.24131974Mitochondrial-encoded large-subunit rRNA
1855CATGATTGTTAAGAAAGCGCA113214.48724537−1.06856412838.94005873Unresolved SAGE tag
11533CATGATTTGTCGACCGAAGAT024019.30477518Uniquely absent24.33753671Putative fructose-1,6-bisphosphate aldolase
25408CATGAACTACTTCTTGAATTC01199.127231112Uniquely absent23.12065987Orphan SAGE tag
25238CATGGCCAGTGTGAAGCTTAG123515.10682258−2.13712825621.29534462Orphan SAGE tag
1083CATGAGCTACCTTTACGATGA11112.73122985910.294187980.821775854Orphan SAGE tag
294CATGGTTAGGCGAGTGGCAGT11122.3156411910.294187982.433753671Orphan SAGE tag
827CATGCTCGGTGTGGGGTGGCG9102.9349296928.422517436Uniquely absentOrphan SAGE tag
1041CATGGCGCAACCCGGGGGCGC9102.9349296928.422517436Uniquely absentOrphan SAGE tag
128CATGGTGCTCCTCCCGCTGTC8102.5515111497.486682165Uniquely absentEST has no meaningful BLASTX hit
  • a The Tag identification (ID) can be used to view the data on a particular tag at http://gmod.mbl.edu/emiliania_huxleyi.

  • b Raw frequencies in each SAGE library are presented for each tag.

  • c Change (n-fold) includes correction for sampling depth, with negative symbols used for down-regulation. The top five tags are presented for each library.

  • d Unresolved SAGE tags are tags matching more than one EST or genome sequence. Orphan SAGE tags are tags not having a sequence match in all available EST and genome sequences.