TABLE 1.

16S rRNA and other oligonucleotide probes used for FISH analysis and formamide concentrations required for optimum specificity

ProbeaTargetProbe sequence (5′-3′)Formamide concn (%)Reference
EUB338EubacteriaGCTGCCTCCCGTAGGAGT0-503
ARCH915ArchaeaGTGCTCCCCCGCCAATTCCT4036
ALF1Bα-Proteobacteria, some δ-Proteobacteria, and most spirochetesCGTTCGYTCTGAGCCAGb2031
BET42ac23S rRNA of most β-ProteobacteriaGCCTTCCCACTTCGTTT3531
GAM41ac23S rRNA of most γ-ProteobacteriaGCCTTCCCACATCGTTT3531
LGC0355Low-G+C-content gram-positive bacteriaGGAAGATTCCCTACTGCTG20This study
TF539Acidithiobacillus ferrooxidansCAGACCTAACGTACCGCC2035
ATT0223Acidithiobacillus thiooxidansAGACGTAGGCTCCTCTTC40This study
LF655Leptospirillum groups 1, 2, and 3CGCTTCCCTCTCCCAGCCT355
ACM732Acidimicrobium and “FerrimicrobiumGTACCGGCCCAGATCGCTG355
ACM995Acidimicrobium ferrooxidansCTCTGCGGCTTTTCCCTCCATG10Norrisd
FMR0732Streamer isolates KP1 and CS11GTGTCGGCCCAGATTGCTG30This study
ABI0199Streamer isolate PK35CTCCTCAAGTGGATTACTC10This study
ABI1002eStreamer isolate KP3CTATTTCTAGGGGTGTCC10This study
ABI1002 h1fUpstream of ABI1002ATACAGACCCATTGCTGG10This study
ABI1002 h2fDownstream of ABI1002TGTACATTTCGAGCCCAG10This study
TM1G0138Thiomonas group 1GCAGTTATCCCCCATCAAT40This study
TM2G0138Thiomonas group 2GTAGTTATCCCCCATCACA40This study
WJ20646eγ-Proteobacteria WJ2 and streamer isolate PK51TACCGTACTCCAGCAAGC40This study
WJ20646 h1fUpstream of WJ20646GGGAATTCCACCTTTCTC40This study
WJ20646 h2fDownstream of WJ20646CAGTATCCACCGCCATT40This study
GALTS0084eStreamer clone TrefC4CCACTAACCTGGGAGCAA40This study
GALTS h1fUpstream of GALTS0084GATATATTACTCACCCGTTCG40This study
GALTS h2fDownstream of GALTS0084GCCCCCAGGCCCGTTCGA40This study
BSC0459Streamer clones TrefC11 and MPKCSC9TCCAGGTTATTCGCCTGA30This study
  • a Most probes were labeled with the fluorochrome Cy3; the only exception was the EUB338 probe, which was labeled with the fluorescein derivative Alexa-fluor 488.

  • b Y = C or T.

  • c Hybridization with probes BET42a and GAM41a was carried out in the presence of a 10-fold excess of the other unlabeled oligonucleotide.

  • d P. Norris (University of Warwick, United Kingdom), unpublished data.

  • e Equal concentrations of unlabeled helper oligonucleotide probes were used with probes ABI1002, WJ20646, and GALTS0084.

  • f Unlabeled helper probe used in conjunction with a labeled partner to enhance fluorescence.