TABLE 1.

Oligonucleotide primers used during nested PCRs to amplify PIB-type ATPases and numbers of isolates which yielded amplicons

PCRPrimercPrimer sequenceTarget genus/generaAnnealing temp (°C)No. of Pbr isolates that yielded a PCR product
1a79JC5′ TGACTGGCGAATCGGTBCCBG 3′Bacillus, Acinetobacter, Pseudomonas598
84JC5′ GGAGCATCGTTAATDCCRTCDCC 3′
132JC5′ CTAACTGGCGAATCAGTCCC 3′Arthrobacter5525
84JC5′ GGAGCATCGTTAATDCCRTCDCC 3′
2b81JC5′ GGATGTCCTTGTGCTYTART 3′Bacillus, Acinetobacter, Pseudomonas495
84JC5′ GGAGCATCGTTAATDCCRTCDCC 3′
133JC5′ CCCTCACCTTGTGCYCTGG 3′Arthrobacter4923
84JC5′ GGAGCATCGTTAATDCCRTCDCC 3′
  • a Expected product size, approximately 1.2 kb.

  • b Expected product size, approximately 0.75 kb.

  • c See reference 11 for specific thermocycling parameters.