TABLE 1.

Real-time PCR assays used to detect Bacteriodes 16S rRNA genes, the primers and probe used for each assay, and the annealing temperature used for each assay

AssayPrimer/probe name and sequence (5′-3′)aSize (bp) of productAnnealing temp (°C)
AllBac (all Bacteroides)AllBac296f, 5′-GAGAGGAAGGTCCCCCAC-3′10660
AllBac412r, 5′-CGCTACTTGGCTGGTTCAG-3′
AllBac375Bhqr, 5′-(FAM)CCATTGACCAATATTCCTCACTGCTGCCT(BHQ-1)-3′
BoBac (bovine cluster of Bacteroides)BoBac367f, 5′-GAAG(G/A)CTGAACCAGCCAAGTA-3′10057
BoBac467r, 5′-GCTTATTCATACGGTACATACAAG-3′
BoBac402Bhqf, 5′-(FAM)TGAAGGATGAAGGTTCTATGGATTGTAAACTT(BHQ-1)-3′
HuBac (human cluster of Bacteroides)HuBac566f, 5′-GGGTTTAAAGGGAGCGTAGG-3′11660
HuBac692r, 5′-CTACACCACGAATTCCGCCT-3′
HuBac594Bhqf, 5′-(FAM)TAAGTCAGTTGTGAAAGTTTGCGGCTC(BHQ-1)-3′
  • a Numbers within the primer/probe name indicate the nucleotide position within the Bacteroides 16S rRNA gene.