TABLE 2.

Oligonucleotide primers used in this study

PrimerSequence (5′-3′)aRestriction siteDesignationSource or accession no.
1GCGGATCCGCATGAGCCTCGGCGCAAAGCCABamHIlinB-senseD14594
2GCCTCGAGTTATGCTGGGCGCAATCGCCGGACXhoIlinB-antisenseD14594
3GCGAATTCCATGAGCCTCGGCGCAAAGCCAEcoRIlinB-sensebThis study
4GCGGTACCAAAATGAGCCGGTTCKpnIlinB-sense with promoter and SD sequencesThis study
5GCGGTACCCGATTCCTCGATTGAKpnIlinB-antisenseThis study
6AAGAATTCTAAGCTCAACGGATGCEcoRIIS6100-senseAY331258
7ATGAATTCCCTTGCTGCCCACGGAEcoRIIS6100-antisenseAY331258
  • a Restriction sites are underlined.

  • b The sense primer contained an EcoRI site for linB amplification from Sp+ because linB of Sp+ contains a BamHI site within the ORF.