TABLE 4.

Oligonucleotide primers used in this studya

PrimerSequence (5′-3′)UseSource
PSFGG(AT)C(AGT)AC(ACT)GG(ACT)(AC)A(AGCT)CC(ACT)AA(AG)GGDegenerate PCR (A domain)Carnio et al.b
PSR2GGCA(GT)CCAT(CT)T(CT)GCCA(AG)GTC(AGCT)CC(GT)GTDegenerate PCR (A domain)Carnio et al.b
F_C3GCA(CT)CA(CT)AT(ACT)AT(ACT)TC(AGCT)GA(CT)GG(AGCT)TGGModule jumping (C-A domain)This study
R_T1C(AGT)A(GT)(AGT)A(AG)(AT)GA(AG)TG(ACT)CC(AC)CCModule jumping (A-T domain)This study
F_VallGAACCTTGAACAATTAACAGAAGModule jumping (A-T domain)This study
CesF1GGTGACACATTATCATATAAGGTGMolecular diversity; cereulide-specific PCR assayThis study
CesR1GTTTTCTGGTAACAGCGTTTCTACMolecular diversityThis study
CesR2GTAAGCGAACCTGTCTGTAACAACAModule jumping (C-A domain); cereulide-specific PCR assayThis study
8-26/56AGAGTTTGATCCTGGCTCA16S rRNA gene amplification (positive control)Stackebrandt and Liesackc
1511-1493CGGCTACCTTGTTACGAC16S rRNA gene amplification (positive control)Stackebrandt and Liesackc
CF1CCAATTTTCCAAGTGATGATGGGProbe for hybridization (C domain)This study
CR1CAATAATTGTTTCAGGCGAACGCAProbe for hybridization (C domain)This study
AF1TGTTGTTACAGACAGGTTCGCTTACProbe for hybridization (A domain)This study
AR1GTTCCAATCGGAATGCTGTCTTGProbe for hybridization (A domain)This study
  • a Primers used for inverse PCR and control sequencing reactions are not shown.

  • b See reference 6.

  • c See reference 41.