TABLE 2.

Oligonucleotide primers

Primer5′→3′ sequenceaPurpose
MILVNFGCGGAGGAAGTACTGCCilvN mutation
MILVNRCAATCAGATTAATTGCTGTTTAilvN mutation
ILVNM1GGACGTAGACGGTGACATTTCCCGCGilvN mutation
            AT
MISBGLGTTTAGAACTTGGCCGGAGilvN mutation
ILVNM13FAGGACGTGACGATGACTTTTCCCGCGTATilvN mutation
ILVNM13RATACGCGGGAAAAGTCATCGTCTACGTCCTilvN mutation
DELN1FCTGAATTCCGGTGGACTGGGCACCilvN deletion
DELN1RTTGAATGCGCTCTCTCCTTATGCCTCGGTCilvN deletion
DELN2FTAAGGAGAGAGCGCATTCAACCTCGTGTCCilvN deletion
DELN2RCCGAATTCAAGGAGAGGTCAGCGTCilvN deletion
DELPANBF1AACTGCAGCGCAAGAAGGTCTpanB deletion
DELPANBR1AATCGTCTGCATCGCGACCCAGCACAACGTpanB deletion
DELPANBF2GGGTCGCGATGCAGACGATTCGACGCATTGpanB deletion
DELPANBR2AACTGCAGGGGATTGACAApanB deletion
DELILVAF1AGGAATTCAGAGGACTGAGCCTGilvA deletion
DELILVAR1TGGTTCGATAGGCCACGCCCTGGGCATGGTilvA deletion
DELILVAF2GGGCGTGGCCTATCGAACCAGCGGGAGCAGilvA deletion
DELILVAR2AAGAATTCGTACTCAGGAGTGCCilvA deletion
  • a Mutated bases are in boldface; restriction sites (ScaI, EcoRI, or PstI) are in italics.