TABLE 1.

Oligonucleotide primers used in this study

Target genePrimerSequence (5′-3′)aApplication
msrB130forward1TGACTGGATCCTAATATGATCGATTTGATGAACCInsert primer
130reverse1TGACTGAATTCCCTTACTTCTTACCTCAGTCCInsert primer
130kon1GTAACGAAAACGAGGAGGATGCTest primer
130kon2GTCGTCCTTCGCTTTATGACTest primer
xylA139Pr1TGACTGGATCCTAAGTTCTTTGGAATACTTCAAACCInsert primer
139Pr2TGACTGAATTCGTTCAAGAAGCATTTGAGCGTCInsert primer
139ivet2TGAAGGATTGGCTTCGTTTCTCTest primer
139kon2ATATTGGTGAGTAGTTGGTTCCTest primer
met146vor1TGACTTCTAGATAATTTGCAAACGGCGAAATAACACInsert primer
146rück1TGACTGGATCCTTCGGGACGAAGAAATTCTTCInsert primer
146ivet4TTATTGCTTCAATTCTTGAACCTest primer
146test1AAGCAGCGGCAACGTCATGATCTest primer
lspLspvor1TGACTGGATCCTAAAATAGTGAAGCTGGTAGTCAACCInsert primer
Lsprück1TGACTGAATTCTATTAGCAACGGTAATATCACInsert primer
LspPr1GCAAGAGCCGAAAAAGCAACTest primer
Lsptest1CTGGATTAGGTCGACGAATTCCTest primer
LSPprobeForwCCAGATTCGAGCGATATTACProbe
LSPprobeRevGATCTTGGTAACCTGCGACProbe
  • a Restriction sites are italic; translation stop codons are printed in boldface.