TABLE 1.

Sequence alignments of norovirus sequences obtained from GenBank

Sample nameAccession no.Sequence alignmenta
Amplification product (primers SRII-2 and SRII-3)
    BAG86SRII-3 AF405525 CCGAGGAAGGTCAAACCATCCAGGTCCTCAGAAATGATCAGGGGTCCCTCAGTCTTGTCAGGGCGGGTTGGCTTCAGCCCAT
    BAG85SRII-3 AF405524 -------------------------CCTCGCAAATGATCAGGGGTCCCTCAGTCTTGTCAGGGCGGGTTGGCTTCAGCCCAT
    BAG84SRII-3 AF405523 -CGAGGAAGGTGAAACC-TCCAGGTCCTCAGAAATGATCAGGGGTCCCTCAGTCTTGTCAGGGCGGGTTGGCTTCAGCCCAT
*******************************************************
    BAG86SRII-3 AF405525 ACTCTTTCAGTTTTGCTGTTAATCTTTCTGGGTCCAATTTTATATCTGTGCTCACAATCTCATCATCACCATAGAAGGAGAAG
    BAG85SRII-3 AF405524 ACTCTTTCAGTTTTGCTGTTAATCTTTCTGGGTCCAATTTTATATCTGTGCTCACAATCTCATCATCACCATAAAAGGAGAA-
    BAG84SRII-3 AF405523 ACTCTTTCAGTTTTGCTGTTAATCTTTCTGGGTCCAATTTTATATCTGTGCTCACAATCTCATCATCAACATAAAAAGAGAA-
*******************************************************************************
Amplification product (primers Mon 431/432 and Mon 433/434)
    BAG16Mon431 AF405526 -------CACACACTCCCAGAGGCCCATACAACTGATGTCTTTGCTGGGTGAGGCAGCACTTCACGGCCCAGCATTCTATAGCAAAATT
    BAG18Mon431 AF405528 CTATGATACCACACTCCCAGAGGCCCATACAACTGATGTCTTTGCTGGGTGAGGCAGCACTTCACGGCCCAGCATTCTATAGCAAAATT
    BAG17Mon431 AF405527 -----ATACCACACTCCCAGAGGCCCATACCACTGATGTCTTTGCTGGGTGAGGCAGCACTTCACGGCCCAGCATTCTATAGCAAAATT
*******************************************************************************
    BAG16Mon431 AF405526 AGTAAGCTAGTTATTGCAGAGCTGAAGGAAGGTGGCATGGATTTTTACGTGCCCAGACAAGAGGCAATGTTCAGATGGATGAGATTCA-
    BAG18Mon431 AF405528 AGTAAGCTAGTTATTGCAGAGCTGAAGGAAGGTGGCATGGATTTTTA GTGCCCAGACAAGAGCCAATGTTCAGATGGATGAGATTCAA
    BAG17Mon431 AF405527 AGTAAGCTAGTTATTGCAGAGCTGAACCAAGGTGGCATGGATTTTTACGTGCCCTGACAAGAGCCAATGTTCAGATGGATGAGATTCA-
***********************************************************************************
  • a The region corresponding to primer sequences SRII-2 and Mon433 (first and second alignments, respectively) is in boldface. Asterisks indicate identical positions.