TABLE 5

Primers and real-time PCR conditions

PCR target (gene)Primer namePrimer sequence (5′ to 3′)Amplicon size (bp)PCR cycling conditions
Total bacterial population (16S)16S FTCCTACGGGAGGCAGCAGT4663 min at 95°C, followed by 35 cycles of 15 s at 95°C, 1 min at 60°C, and 1 min at 72°C
16S RGGACTACCAGGGTATCTAATCCTGTT
Lactobacillus (16S)UF-lacTTTAYGCGGAACAYYTRGGKGT4502 min at 95°C, followed by 40 cycles of 60 s at 95°C, 90 s at 55°C, 90 s at 57°C, and 120 s at 72°C
UR-lacCCAAACATCACVCCRACTT
Total fungal population (18S)FR1AICCATTCAATCGGTAIT3905 min at 98°C, followed by 40 cycles of 15 s at 98°C, 30 s at 50°C, and 30 s at 72°C
FF390CGATAACGAACGAGACCT
Yeast population (26S)TQ 26S 1BTCAGGATAGCAGAAGCTCGT3325 min at 98°C, followed by 40 cycles of 15 s at 98°C, 30 s at 64°C, and 30 s at 72°C
TQ 26S 2CGTTCATTCGGCCGGTGAGTT