TABLE 2.

Genes whose expression levels were investigated by quantitative real-time PCR in both the nitrogen fixation and Fe(III) reduction experimental conditions

Locus identification no.Common namePrimer sequence
ForwardReverse
GSU0003DNA gyrase, B subunitAAGGGTGAAAAGGCAGGAGTTCGTGGGTGTTGATGTTGTT
GSU0782Nickel-dependent hydrogenase, small subunitGGTGATCTGGCTTCACTTCCTCCAGCGAAATCATGTCAAG
GSU0783Nickel-dependent hydrogenase, iron-sulfur cluster-binding proteinCTACGGCGAGAAGGAAGTTGCCCCTTGTAGATGGTGTGCT
GSU0784Nickel-dependent hydrogenase, membrane proteinACTCGGTCATGTTCGAGGTCTAGAGCCAGTGGGACGATTC
GSU1305Glu/Leu/Phe/Val dehydrogenase family proteinCCGAAGGGGTCAAGGTATTTGCTTCTTCTCGGTGTCTTCG
GSU1331Efflux transporter, RND family, MFP subunitATCGAAGGGCAGTACGTGAAGAGGCAGAAGTCACCTCGAC
GSU1379Ferric uptake regulation protein FurTCCATGATTACATCGCCAAGCCCTGAGCTTGAGGTACAGC
GSU1470Keto/oxoacid ferredoxin oxidoreductase, gamma subunitCAACATCGTTGCTCTTGGTGCTCGAAACCCATCTGGAAAG
GSU1496Pilin domain proteinCCAACACAAGCAGCAAAAAGGCAGCGAGAATACCGATGAT
GSU1836Nitrogen regulatory protein P-IICGTGGATTTTATCCCCAAGATGCGGATAACCTCTTCAACC
GSU2408Heat shock protein, Hsp20 familyGGAACGGGTTCATGACAAAGCATGAAGGCTGGCAAGGTAT
GSU2409Heat shock protein, Hsp20 familyTGAAGAGACACGGTCAAACGTGACATCCAGGGTTTCCTTC
GSU2490Oxalate/formate antiporter, putativeGTTCCAGGCAGTCCTCATGTCCCCAGTAATCCTTGCTGAA
GSU2751C4-dicarboxylate transporter, anaerobicATCTCCGCCTTTGTGAAGAGCAAGGTCGCTGGGATAGAAG
GSU2779Transcriptional regulator, MerR familyGGCAGTGGACAAGGAGATGTGGGAGAGCAAAAACTGATGG
GSU2804Ferredoxin family proteinAGTTCGTCGTCTCCATCGACGAATCGTCTTCGTCCACCTC
GSU2821Nitrogenase iron proteinAAGCTCGGCACTCAGATGATGCTTGTGCTCGGGAGAATAC
GSU3125Alcohol dehydrogenase, zinc containingTGGTGGTTTTCACCACCTCTGTCGAGGATGAAGTCGAACG