TABLE 1.

Primers and linkers used in this study

Primer or linkerSequence (5′-3′)aReference or source
AciBac32FAATATAAACCGCAACGCTAGCTACAGGCTT2
Aci422RAATATAAACCGCWSTCAGGAGTATTTAGCCTT21
Linker S1CGCCAGGGAACACCCAGTCACGAC27
Linker S2CGGTCGTGACTGGGTGTTCCCTGGCG27
Linker T1AGGGGATAACCAATTCACACACCA27
Linker T2CGTGGTGTGTGAATTGGTTATCCCCT27
EF447FAATAACACCATCTACGTGTAGAThis study
EF990RGCCTGTCCAGTGCAATTTAAThis study
DF475FCGCTTGTATGTACCGGTACGThis study
Bac708RCAATCGGAGTTCTTCGTG2
  • a Restriction site extensions and overhangs are underlined.