TABLE 2.

Oligonucleotide primer sequences and their locations

PrimerOligonucleotide sequence (5′ → 3′)Position (accession no.)Reference
16GCTGGATCACCTCCTTTC5
23-10CCCTTTCCCTCACGGTACTG23
MulISRFCACCGCCCGTCACACCATG1419-1437 (X52653)This study
MulISRRGCCTTGSGAGATGGTCCTC657-675 (AJ616224) reversedThis study
ISRMulRCCGTACTCAGGATHCTGAA601-619 (AJ616016) reversedThis study
Gru1′′′FGCAGTTTTAATCAACTGTTACC335-356 (AJ616224)This study
Gru2′′FAGGGTTGTAGGACTGATGTTG492-512 (AJ616016)This study
Gru3FGGGGAACTGAAACATCTMAGTACCC408-432 (AJ616221)This study
Gru4FCGCAACGAGCGCAACCCTTGTTAC1058-1081 (AJ422032)This study
LrosFGTATCTGAGAGTAACTGTTCAGA11
LrosRAGGGAACGTCCGATCTCTCG11
paraFGTCACAGGCATTACGAAAAC57
pentFCAGTGGCGCGGTTGATATC57
planFCCGTTTATGCGGAACACCTA57
pREVTCGGGATTACCAAACATCAC57
LaliFTAGTTGAGATAGCTGAACAGC529-549 (AJ616015)This study
LfarFCTACTTTCACATGATCGTAGC194-214 (AJ417499)This study
LminFGGTAGGATGATGCGTAAGCAT1543-19 (AJ313530-AJ616016)This study
LpalFGACGAAAGTCATGGCAAATTG163-183 (AJ616014)This study
LbreFTTTGACGATCACGAAGTGACCG196-217 (AJ616223)This study
LfrucFCGACAGTGAATTCATAGCTGTCG375-397 (AJ616220)This study
LhilFCGGAAACCTACACAATGTCG8-27 (AJ616222)This study
Lsan′FTGAAGTAGTTGGGAAGCTACA557-577 (AJ616221)This study
LferFAAGAATCAGGTAGTCGAAGTG527-547 (AF182720)This study
Lfru′FCACCGCGTTATTTTGAGTTGT126-146 (AJ616011)This study
Lpan′′FCCAACTTAGTCGTTGGTTATC336-356 (AJ616012)This study
LponFTCAAAACCACATGGTTTTGATTTC136-159 (AJ422032)This study
LacbFTGCCTAATACATGCAAGT12
LacbRCTTGTTACGACTTCACCC12
LABRGATCCGCGATTACTAGCG1352-1369 (X54268) reversedThis study