TABLE 2.

List of sequence-specific primers

Primer nameDescriptionSequence (5′-3′)a
PepO3-For-BamHIForward, amplification of pepO3CGGGATCCTTTTGACTTTGGGTGAAT
PepO3-Rev-KpnIReverse, amplification of pepO3GGGGTACCACGAGAAGTGGTTAGTTGA
PepF-For-BamHIForward, amplification of pepFCGGGATCCCTTAAGGGAGTTCGGAG
PepF-Rev-KpnIReverse, amplification of pepFGGGGTACCTTGGAGGAATTCATCTTTAG
PepE2-For-BamHIForward, amplification of pepE2CGGGATCCTATAACAAGAACGCTAAGAA
PepE2-Rev-KpnIReverse, amplification of pepE2GGGGTACCCAGATAATGGCAAATGATA
PepE-For-SmaIForward, amplification of pepETCCCCCGGGATTAGATTAAGCAAG
PepE-Rev-XbaIReverse, amplification of pepEGCTCTAGAGAAATTCGCCCTGGTC
KpnI-PpepO3-ForForward, amplification of PpepO3GGGGTACCGACTTTGGGTGAATC
BamHI-PpepO3-RevReverse, amplification of PpepO3CGGGATCCCATTTTATTATTCAAAGAGAA
BamHI-PepF-ORF-ForForward, amplification of pepF ORFCGGGATCCCCAACAAGAAGCGAAGTC
SacI-PepF-ORF-RevReverse, amplification of pepF ORFGCTGGAGCTCGTCAGCTTTTTGTATGG
BamHI-PepO2-ORF-ForForward, amplification of pepO2 ORFCGCGGATCCAATTTAGCAAAAATC
XbaI-PepO2-ORF-RevReverse, amplification of pepO2 ORFGCTCTAGATCAATTATATAACTGATAC
BamHI-PepE-ORF-ForForward, amplification of pepE ORFCGGGATCCGAATTAACTGTGCAGG
XbaI-PepE-ORF-RevReverse, amplification of pepE ORFGCTCTAGAGAAATTCGCCCTGGTC
  • a The restriction site included in each primer is underlined.