TABLE 1.

PCR primer sequences

TargetPrimerDirectionaPrimer sequence (5′→3′)Reference
Cyanobacterial 16S rRNACYAFACGGGTGAGTAACRCGTRA46
RCTTCAYGYAGGCGAGTTGCAGC
Microcystis 16S rRNAMICFATGTGCCGCGAGGTGAAACCTAAT30
RTTACAAYCCAARRRCCTTCCTCCC
Microcystis mcyDmcyDFGGTTCGCCTGGTCAAAGTAA18
RCCTCGCTAAAGAAGGGTTGA
Microcystis mcyBmcyBFTGGGAAGATGTTCTTCAGGTATCCAA32
RAGAGTGGAAACAATATGATAAGCTAC
Microcystis, Anabaena, and Planktothrix sp. mcyAmcyAFAAAAGTGTTTTATTAGCGGCTCAT14
RAAAATTAAAAGCCGTATCAAA
Microcystis, Anabaena, and Planktothrix sp. mcyEmcyEFGAAATTTGTGTAGAAGGTGC47
Microcystis sp. mcyERCAATGGGAGCATAACGAG
Anabaena sp. mcyERCAATCTCGGTATAGCGGC
Planktothrix sp. mcyERCTCAATCTGAGGATAACGAT36
  • a F, forward; R, reverse.