TABLE 1.

Fluorescent probes used in this studya

Common probe nameGeneric nameTarget(s)Sequence (5′-3′)Position no.Reference(s)
NON338NANoneACTCCTACGGGAGGCAGCNA37
EUB338-IS-D-Bact-0338-a-A-18Most BacteriaGCTGCCTCCCGTAGGAGT338-3551, 9
EUB338-IIS-*-BactP-0338-a-A-18PlanctomycetalesGCAGCCACCCGTAGGTGT338-355
EUB338-IIIS-*-BactV-0338-a-A-18VerrucomicrobialesGCTGCCACCCGTAGGTGT338-355
DELTA495AS-C-dProt-0495-a-A-18Most DeltaproteobacteriaAGTTAGCCGGTGCTTCCT495-51227
DELTA495BS-*-dProt-0495-b-A-18Some DeltaproteobacteriaAGTTAGCCGGCGCTTCCT495-512
DELTA495CS-*-dProt-0495-c-A-18Some DeltaproteobacteriaAATTAGCCGGTGCTTCCT495-512
GEO3-AS-G-Geob-0818-a-A-21Geobacter clusterCCGCAACACCTAGTACTCATC818-838This study
GEO3-BS-G-Geob-0818-b-A-21CCGCAACACCTAGTTCTCATC818-838
GEO3-CS-G-Geob-0818-c-A-21CCGCAACACCTGGTTCTCATC818-838
DMONAS-AS-G-Dmona-0433-a-A-21Desulfuromonas clusterTTTCTTCCCCTCTGACAGAGC433-453This study
DMONAS-BS-G-Dmona-0433-b-A-21TTTCTTCCCTCTTGACAGAGC433-453
DMONAS-CS-G-Dmona-0433-c-A-21TTTCTTTCCTCCTGACAGAGC433-453
DMONAS-DS-G-Dmona-0433-d-A-21GTTCTTCCCCTCTGACAGAGC433-453
PCARB1S-S-Pcarb-0455-a-A-18P. carbinolicusGCCTATTCGACCACGATA455-470This study
GEO2S-S-Gsulf-0207-a-A-19G. sulfurreducensGAAGACAGGAGGCCCGAAA207-225This study
HGEO2-1S-S-Gsuh1-0114-(PCA)-a-A-22Helper probes for GEO2GTCCCCCCCTTTTCCCGCAAGA114-135This study
HGEO2-2S-S-Gsuh2-0226-a-A-22G. sulfurreducensCTAATGGTACGCGGACTCATCC226-243
HGEO3-3S-G-Geoh3-0798-a-A-20Helper probes for GEO3GTTTACGGCGGGTACTACC798-817This study
HGEO3-4S-G-Geoh4-0839-a-A-18CACTGCAGGGGTCAATAC839-856
  • a NA, not available.