TABLE 2

Campylobacter-specific primers used in the study

PrimerSequence (5′→3′)Gene and/or species (product size [bp])Reference
CampF2CACGTGCTACAATGGCATATCampylobacter spp. 16S rRNA36
CampR2GGCTTCATGCTCTCGAGTT
CampP2 (probe)FAM-CAGAGAACAATCCGAACTGGGACA
hipOUGAAGAGGTTTGGGTGGTGC. jejuni (735)37
hipORAGCTAGCTTCGCATAATAACTTG
flaA-FGGATTTCGTATTAACACAAATGGTGCfla (1,728)40
flaA-RCTGTAGTAATCTTAAAACATTTTG
Fla242 FUCTATGGATGAGCAATT(AT)AAAATfla (383)41
FLA625RUCAAG(AT)CCTGTTCC(AT)ACTGAAG
LYA-FCTTTATGCATGTTCTTCTAAATTTcdt gene cluster20
MII-RGTTAAAGGTGGGGTTATAATCATT
cadFUTTGAAGGTAATTTAGATATGcadF (400)43
cadFRCTAATACCTAAAGTTGAAAC
Forward
    lpxA C. coliAGACAAATAAGAGAGAATCAGC. coli lpx (391)38
    lpxA C. jejuniACAACTTGGTGACGATGTTGTAC. jejuni lpx (331)
    lpxA C. lariTRCCAAATGTTAAAATAGGCGAC. lari lpx (233)
    lpxA C. upsaliensisAAGTCGTATATTTTCYTACGCTTGTGTGC. upsaliensis lpx (206)
Reverse
    lpxAARKK2 MCAATCATGDGCDATATGASAATAHGCCAT
DS18CCTTGTGATGCAAGCAATCcdtA-cdtB (450)39
DS15ACACTCCATTTGCTTTCTG